Incidental Mutation 'R4280:Cd274'
ID322873
Institutional Source Beutler Lab
Gene Symbol Cd274
Ensembl Gene ENSMUSG00000016496
Gene NameCD274 antigen
SynonymsPdcd1lg1, B7-H1, PD-L1
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location29367455-29388095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29380471 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 188 (M188L)
Ref Sequence ENSEMBL: ENSMUSP00000016640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016640]
Predicted Effect probably benign
Transcript: ENSMUST00000016640
AA Change: M188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016640
Gene: ENSMUSG00000016496
AA Change: M188L

DomainStartEndE-ValueType
IG 24 131 1.5e-7 SMART
IG_like 138 226 4.78e1 SMART
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: The protein encoded by this gene is an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Mice deficient for this gene display a variety of phenotypes including decreased allogeneic fetal survival rates and severe experimental autoimmune encephalomyelitis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered susceptibility to experimental autoimmune encephalomyelitis, induced arthritis, nerve injury, autoimmune diabetes, bacterial infection, viral infection, and parasitic infection due to abnormal T cellmorphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Cd274
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Cd274 APN 19 29385410 makesense probably null
IGL02232:Cd274 APN 19 29382538 missense probably damaging 0.99
IGL03304:Cd274 APN 19 29384102 missense probably damaging 0.99
R1233:Cd274 UTSW 19 29373901 critical splice donor site probably null
R1356:Cd274 UTSW 19 29373570 missense possibly damaging 0.92
R1464:Cd274 UTSW 19 29382592 splice site probably benign
R1853:Cd274 UTSW 19 29380482 missense probably damaging 1.00
R4283:Cd274 UTSW 19 29380471 missense probably benign
R4553:Cd274 UTSW 19 29380448 missense probably benign 0.43
R5063:Cd274 UTSW 19 29384143 missense probably damaging 0.99
R5122:Cd274 UTSW 19 29380565 missense possibly damaging 0.57
R5187:Cd274 UTSW 19 29382536 missense probably benign 0.01
R5736:Cd274 UTSW 19 29382540 missense probably benign 0.02
R6400:Cd274 UTSW 19 29385408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGGCTAGCCCTAAGATG -3'
(R):5'- GCTAAATGACTATGGCGGATGG -3'

Sequencing Primer
(F):5'- AGAGCCCTGACCTCTCTTTG -3'
(R):5'- ATGGCCATCGTGCTAGGAATC -3'
Posted On2015-06-20