Incidental Mutation 'R4280:Supt5'
List |< first << previous [record 38 of 47] next >> last >|
ID322841
Institutional Source Beutler Lab
Gene Symbol Supt5
Ensembl Gene ENSMUSG00000003435
Gene Namesuppressor of Ty 5
SynonymsSupt5h, Spt5
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28314891-28338746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28317073 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 761 (R761W)
Ref Sequence ENSEMBL: ENSMUSP00000147164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003527] [ENSMUST00000207563] [ENSMUST00000209141]
Predicted Effect probably damaging
Transcript: ENSMUST00000003527
AA Change: R761W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003527
Gene: ENSMUSG00000003435
AA Change: R761W

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
coiled coil region 36 63 N/A INTRINSIC
Pfam:Spt5_N 73 170 8.1e-17 PFAM
NGN 174 265 2.2e-14 SMART
KOW 270 297 8.77e0 SMART
KOW 417 444 8.69e-4 SMART
KOW 469 496 9.1e-7 SMART
KOW 591 618 2.46e-3 SMART
low complexity region 677 695 N/A INTRINSIC
KOW 697 724 3.93e-2 SMART
CTD 766 902 2.09e-31 SMART
KOW 1028 1055 9.69e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209105
Predicted Effect probably damaging
Transcript: ENSMUST00000209141
AA Change: R761W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.0324 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Supt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Supt5 APN 7 28315382 missense probably benign 0.08
IGL01077:Supt5 APN 7 28323788 nonsense probably null
IGL01477:Supt5 APN 7 28317264 missense possibly damaging 0.94
IGL01813:Supt5 APN 7 28323975 missense probably damaging 0.99
IGL02405:Supt5 APN 7 28315824 missense probably benign 0.00
IGL02525:Supt5 APN 7 28318947 splice site probably benign
IGL02584:Supt5 APN 7 28326167 missense probably benign 0.08
IGL03387:Supt5 APN 7 28320083 missense possibly damaging 0.89
R0420:Supt5 UTSW 7 28317329 splice site probably benign
R0715:Supt5 UTSW 7 28329037 missense probably damaging 1.00
R1226:Supt5 UTSW 7 28328747 missense probably benign 0.03
R1655:Supt5 UTSW 7 28330024 missense probably benign 0.00
R1801:Supt5 UTSW 7 28317214 critical splice donor site probably null
R2424:Supt5 UTSW 7 28315165 missense possibly damaging 0.47
R2883:Supt5 UTSW 7 28329320 missense possibly damaging 0.75
R4614:Supt5 UTSW 7 28325972 missense possibly damaging 0.65
R4792:Supt5 UTSW 7 28316329 missense probably benign 0.19
R4997:Supt5 UTSW 7 28316037 missense probably benign 0.05
R5041:Supt5 UTSW 7 28315380 missense probably damaging 1.00
R5062:Supt5 UTSW 7 28329015 splice site probably null
R5119:Supt5 UTSW 7 28316370 missense probably damaging 1.00
R5170:Supt5 UTSW 7 28316083 missense probably benign 0.05
R5687:Supt5 UTSW 7 28317763 missense probably benign 0.27
R5720:Supt5 UTSW 7 28322568 missense probably damaging 0.97
R5935:Supt5 UTSW 7 28329475 missense probably benign 0.09
R6032:Supt5 UTSW 7 28316175 missense probably damaging 1.00
R6032:Supt5 UTSW 7 28316175 missense probably damaging 1.00
R6049:Supt5 UTSW 7 28315197 missense probably benign 0.32
R7043:Supt5 UTSW 7 28320010 missense probably benign 0.00
R7085:Supt5 UTSW 7 28331489 missense unknown
R7152:Supt5 UTSW 7 28323900 missense probably benign 0.00
R7201:Supt5 UTSW 7 28316788 missense probably benign 0.03
R7401:Supt5 UTSW 7 28323772 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATAATGTGGAGTGCGGCTG -3'
(R):5'- TAGAACTGCATTCTACCTGCCAG -3'

Sequencing Primer
(F):5'- TGCGGCTGCCTGGATAAAG -3'
(R):5'- AGACCATCTCTGTGGATCGC -3'
Posted On2015-06-20