Incidental Mutation 'R4496:Mal2'
ID330991
Institutional Source Beutler Lab
Gene Symbol Mal2
Ensembl Gene ENSMUSG00000024479
Gene Namemal, T cell differentiation protein 2
Synonyms
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.023) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location54571192-54602847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54598439 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 110 (V110A)
Ref Sequence ENSEMBL: ENSMUSP00000025356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025356]
Predicted Effect probably damaging
Transcript: ENSMUST00000025356
AA Change: V110A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025356
Gene: ENSMUSG00000024479
AA Change: V110A

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Pfam:MARVEL 30 168 4.4e-20 PFAM
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multispan transmembrane protein belonging to the MAL proteolipid family. The protein is a component of lipid rafts and, in polarized cells, it primarily localizes to endosomal structures beneath the apical membrane. It is required for transcytosis, an intracellular transport pathway used to deliver membrane-bound proteins and exogenous cargos from the basolateral to the apical surface. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Mal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01919:Mal2 APN 15 54588332 missense probably damaging 1.00
IGL01960:Mal2 APN 15 54598545 nonsense probably null
IGL02647:Mal2 APN 15 54588437 missense probably damaging 0.96
R1772:Mal2 UTSW 15 54588387 missense probably damaging 0.99
R2015:Mal2 UTSW 15 54600740 makesense probably null
R2248:Mal2 UTSW 15 54588336 missense probably damaging 1.00
R6190:Mal2 UTSW 15 54571398 start gained probably benign
R6275:Mal2 UTSW 15 54571639 critical splice donor site probably null
R6862:Mal2 UTSW 15 54588357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCTCTACAGTTAAGGATGGGC -3'
(R):5'- ATGCTGGACCATGAAAGGAC -3'

Sequencing Primer
(F):5'- CCTCTACAGTTAAGGATGGGCTTATG -3'
(R):5'- GACCATGAAAGGACGATGCTTTTCC -3'
Posted On2015-07-21