Incidental Mutation 'R4496:Comt'
ID330997
Institutional Source Beutler Lab
Gene Symbol Comt
Ensembl Gene ENSMUSG00000000326
Gene Namecatechol-O-methyltransferase
SynonymsD330014B15Rik, Comt1, D16Wsu103e
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18406886-18426852 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 18411687 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000335] [ENSMUST00000090103] [ENSMUST00000115609] [ENSMUST00000115612] [ENSMUST00000115613] [ENSMUST00000115614] [ENSMUST00000147720] [ENSMUST00000150253] [ENSMUST00000165430] [ENSMUST00000232025]
Predicted Effect probably null
Transcript: ENSMUST00000000335
SMART Domains Protein: ENSMUSP00000000335
Gene: ENSMUSG00000000326

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Methyltransf_3 63 224 3.5e-24 PFAM
Pfam:Methyltransf_26 102 224 3.3e-9 PFAM
Pfam:Methyltransf_24 106 214 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090103
SMART Domains Protein: ENSMUSP00000087562
Gene: ENSMUSG00000000325

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115609
SMART Domains Protein: ENSMUSP00000111272
Gene: ENSMUSG00000000326

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Methyltransf_3 63 224 3.5e-24 PFAM
Pfam:Methyltransf_26 102 224 3.3e-9 PFAM
Pfam:Methyltransf_24 106 214 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115612
SMART Domains Protein: ENSMUSP00000111275
Gene: ENSMUSG00000000325

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115613
SMART Domains Protein: ENSMUSP00000111276
Gene: ENSMUSG00000000325

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115614
SMART Domains Protein: ENSMUSP00000111278
Gene: ENSMUSG00000000325

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000147720
SMART Domains Protein: ENSMUSP00000121810
Gene: ENSMUSG00000000326

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Methyltransf_3 62 171 4.1e-18 PFAM
Pfam:Methyltransf_24 106 171 4.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150389
Predicted Effect probably null
Transcript: ENSMUST00000165430
SMART Domains Protein: ENSMUSP00000130077
Gene: ENSMUSG00000000326

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Methyltransf_3 57 221 1.1e-22 PFAM
Pfam:Methyltransf_24 106 214 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232025
Meta Mutation Damage Score 0.6232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Catechol-O-methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine to catecholamines, including the neurotransmitters dopamine, epinephrine, and norepinephrine. This O-methylation results in one of the major degradative pathways of the catecholamine transmitters. In addition to its role in the metabolism of endogenous substances, COMT is important in the metabolism of catechol drugs used in the treatment of hypertension, asthma, and Parkinson disease. COMT is found in two forms in tissues, a soluble form (S-COMT) and a membrane-bound form (MB-COMT). The differences between S-COMT and MB-COMT reside within the N-termini. Several transcript variants are formed through the use of alternative translation initiation sites and promoters. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruption of this gene are viable, fertile, and show no gross or histological abnormalities. However dopamine levels in the frontal cortex of males are increased. Also, males show increased aggression and females show increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Comt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02363:Comt APN 16 18411131 missense probably benign 0.21
IGL02568:Comt APN 16 18411704 missense probably damaging 0.99
IGL03286:Comt APN 16 18411740 missense probably damaging 1.00
R0845:Comt UTSW 16 18407961 missense probably damaging 1.00
R1318:Comt UTSW 16 18407891 missense probably damaging 1.00
R1541:Comt UTSW 16 18411815 missense probably benign 0.20
R5619:Comt UTSW 16 18411719 missense probably damaging 1.00
R6753:Comt UTSW 16 18408021 missense probably benign 0.01
R7286:Comt UTSW 16 18410690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGATAGCCCAGAGGACC -3'
(R):5'- TTTGAGTTCGTGCAGCAGC -3'

Sequencing Primer
(F):5'- GGAGAGTTCACTGGACTTTCACAC -3'
(R):5'- AGCCGGTCCACAACCTG -3'
Posted On2015-07-21