Incidental Mutation 'R4561:Glyat'
ID343116
Institutional Source Beutler Lab
Gene Symbol Glyat
Ensembl Gene ENSMUSG00000063683
Gene Nameglycine-N-acyltransferase
SynonymsA330009E03Rik
MMRRC Submission 041786-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4561 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12633308-12653911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12651280 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 146 (L146F)
Ref Sequence ENSEMBL: ENSMUSP00000114002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044976] [ENSMUST00000119960]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044976
AA Change: L180F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043308
Gene: ENSMUSG00000063683
AA Change: L180F

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 206 1.9e-90 PFAM
Pfam:Gly_acyl_tr_C 207 295 2.8e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119960
AA Change: L146F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114002
Gene: ENSMUSG00000063683
AA Change: L146F

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 172 1.2e-91 PFAM
Pfam:Gly_acyl_tr_C 173 261 3.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157069
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycine-N-acyltransferase protein conjugates glycine with acyl-CoA substrates in the mitochondria. The protein is thought to be important in the detoxification of endogenous and xenobiotic acyl-CoA's. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 70,002,018 S1601P probably damaging Het
Arnt A G 3: 95,452,613 N56D probably damaging Het
Atad5 A G 11: 80,095,889 T601A probably benign Het
Calr4 A G 4: 109,246,182 N163S probably damaging Het
Cenpc1 C A 5: 86,047,632 A93S probably damaging Het
Cep135 C T 5: 76,638,193 H1048Y possibly damaging Het
Ctnna2 A G 6: 77,636,713 probably null Het
Ddx60 T C 8: 61,942,461 L144P probably damaging Het
Dera A T 6: 137,780,738 T96S possibly damaging Het
Dock9 T A 14: 121,559,007 M1853L probably benign Het
Erbb4 G A 1: 68,343,921 R306* probably null Het
Grk4 C A 5: 34,694,813 Q134K probably benign Het
Hkdc1 T C 10: 62,409,839 Q181R probably benign Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ipo4 C T 14: 55,630,089 probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcnd2 A G 6: 21,216,396 Q33R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klhl30 A T 1: 91,361,031 H504L probably damaging Het
Map4 A G 9: 110,052,371 Y101C possibly damaging Het
Mfn2 C A 4: 147,877,035 R707L probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Neb A T 2: 52,286,155 Y1431N probably damaging Het
Nlrc5 A G 8: 94,477,146 T625A probably damaging Het
Olfr996 G T 2: 85,579,620 C127F probably damaging Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pkhd1 A T 1: 20,534,719 L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,682 F189L probably damaging Het
Prex2 G A 1: 11,184,545 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc22a22 T A 15: 57,263,385 Q77L probably damaging Het
Slc24a2 A T 4: 87,227,397 V140D probably damaging Het
Slc35g2 C A 9: 100,553,234 R128L probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Spag7 T C 11: 70,664,990 I80M probably damaging Het
Srgap3 A G 6: 112,781,054 M164T probably damaging Het
Sspo A T 6: 48,475,534 probably null Het
Tcte2 T C 17: 13,722,602 probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tmtc4 T C 14: 122,963,298 T194A probably benign Het
Ttc21b T C 2: 66,186,218 Y1269C probably damaging Het
Zfp236 A T 18: 82,620,406 I1363N probably damaging Het
Zfp760 T A 17: 21,723,667 S608T probably benign Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Glyat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Glyat APN 19 12648133 splice site probably benign
IGL00766:Glyat APN 19 12651262 missense probably benign 0.19
IGL01288:Glyat APN 19 12650355 missense possibly damaging 0.56
IGL02296:Glyat APN 19 12651261 missense probably damaging 0.99
PIT4458001:Glyat UTSW 19 12648009 missense probably benign 0.34
R0416:Glyat UTSW 19 12651453 missense possibly damaging 0.87
R1463:Glyat UTSW 19 12648103 missense probably damaging 1.00
R1750:Glyat UTSW 19 12646315 missense probably benign 0.01
R2416:Glyat UTSW 19 12651254 missense possibly damaging 0.50
R2504:Glyat UTSW 19 12651398 missense possibly damaging 0.82
R2960:Glyat UTSW 19 12639850 missense probably damaging 1.00
R3958:Glyat UTSW 19 12639833 missense probably benign 0.05
R4126:Glyat UTSW 19 12651479 missense probably benign 0.03
R4705:Glyat UTSW 19 12651297 missense possibly damaging 0.68
R5062:Glyat UTSW 19 12650263 missense probably damaging 1.00
R5490:Glyat UTSW 19 12650281 missense probably benign 0.35
R7028:Glyat UTSW 19 12650359 missense probably benign 0.00
R7044:Glyat UTSW 19 12650265 missense probably benign 0.05
Z1088:Glyat UTSW 19 12648009 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAACAACACTGGCCTTTCTG -3'
(R):5'- TGGTCTTGTGAATGGACAACAAAG -3'

Sequencing Primer
(F):5'- CTAGCATAAGCCTATCTATTCCAGG -3'
(R):5'- AAGACCTTGGAGCCGGTACTC -3'
Posted On2015-09-24