Incidental Mutation 'R4993:Slc4a2'
ID384993
Institutional Source Beutler Lab
Gene Symbol Slc4a2
Ensembl Gene ENSMUSG00000028962
Gene Namesolute carrier family 4 (anion exchanger), member 2
SynonymsB3RP, Ae2
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R4993 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24423837-24440950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24434869 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 521 (F521S)
Ref Sequence ENSEMBL: ENSMUSP00000110701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080067] [ENSMUST00000115043] [ENSMUST00000115047] [ENSMUST00000115049] [ENSMUST00000141966]
Predicted Effect probably damaging
Transcript: ENSMUST00000080067
AA Change: F530S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078972
Gene: ENSMUSG00000028962
AA Change: F530S

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 138 151 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 296 313 N/A INTRINSIC
Pfam:Band_3_cyto 348 616 4.7e-111 PFAM
Pfam:HCO3_cotransp 671 1165 1.7e-217 PFAM
transmembrane domain 1183 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115043
SMART Domains Protein: ENSMUSP00000110695
Gene: ENSMUSG00000028959

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 273 341 7.6e-24 PFAM
Pfam:FAST_2 349 440 6.9e-26 PFAM
Pfam:RAP 475 513 1.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115047
AA Change: F516S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110699
Gene: ENSMUSG00000028962
AA Change: F516S

DomainStartEndE-ValueType
low complexity region 79 96 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
low complexity region 155 164 N/A INTRINSIC
low complexity region 186 202 N/A INTRINSIC
low complexity region 282 299 N/A INTRINSIC
Pfam:Band_3_cyto 334 602 7.2e-108 PFAM
Pfam:HCO3_cotransp 656 1151 1e-244 PFAM
transmembrane domain 1169 1186 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115049
AA Change: F521S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110701
Gene: ENSMUSG00000028962
AA Change: F521S

DomainStartEndE-ValueType
low complexity region 84 101 N/A INTRINSIC
low complexity region 103 126 N/A INTRINSIC
low complexity region 129 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Band_3_cyto 339 607 7.3e-108 PFAM
Pfam:HCO3_cotransp 661 1156 1e-244 PFAM
transmembrane domain 1174 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140722
Predicted Effect probably benign
Transcript: ENSMUST00000141966
SMART Domains Protein: ENSMUSP00000117215
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198786
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the anion exchanger family of membrane transport proteins. The encoded protein regulates intracellular pH, biliary bicarbonate secretion, and chloride uptake. Reduced expression of this gene may be associated with primary biliary cirrhosis (PBC) in human patients, while differential expression of this gene may be associated with malignant hepatocellular carcinoma, colon and gastric cancers. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice carrying an isoform-specific allele display male infertility associated with disrupted spermiogenesis and germ cell apoptosis. Mice homozygous for a null allele display perinatal and postnatal lethality, loss of gastric acid secretion, failure of tooth eruption, aphagia, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Slc4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Slc4a2 APN 5 24439068 missense probably damaging 1.00
IGL00772:Slc4a2 APN 5 24435196 missense probably damaging 1.00
IGL00897:Slc4a2 APN 5 24429559 nonsense probably null
IGL01477:Slc4a2 APN 5 24430156 unclassified probably benign
IGL01680:Slc4a2 APN 5 24432930 missense probably benign 0.23
IGL01681:Slc4a2 APN 5 24434187 missense probably damaging 1.00
IGL01808:Slc4a2 APN 5 24440207 missense probably damaging 1.00
IGL02399:Slc4a2 APN 5 24434713 missense probably damaging 1.00
IGL02501:Slc4a2 APN 5 24429434 missense probably benign 0.00
IGL03214:Slc4a2 APN 5 24434881 missense probably benign 0.01
R0238:Slc4a2 UTSW 5 24436274 splice site probably null
R0238:Slc4a2 UTSW 5 24436274 splice site probably null
R0309:Slc4a2 UTSW 5 24434346 missense probably damaging 1.00
R0325:Slc4a2 UTSW 5 24435943 missense probably damaging 1.00
R0656:Slc4a2 UTSW 5 24431259 missense probably benign 0.05
R0755:Slc4a2 UTSW 5 24435577 missense probably benign 0.07
R0946:Slc4a2 UTSW 5 24435886 missense probably damaging 1.00
R1075:Slc4a2 UTSW 5 24439057 missense possibly damaging 0.85
R1733:Slc4a2 UTSW 5 24429567 missense probably damaging 1.00
R1794:Slc4a2 UTSW 5 24439328 missense probably damaging 1.00
R1823:Slc4a2 UTSW 5 24427620 missense probably damaging 0.99
R2048:Slc4a2 UTSW 5 24431559 missense probably damaging 1.00
R2165:Slc4a2 UTSW 5 24431316 missense probably damaging 1.00
R2181:Slc4a2 UTSW 5 24435653 missense possibly damaging 0.80
R2405:Slc4a2 UTSW 5 24435601 missense probably damaging 1.00
R3551:Slc4a2 UTSW 5 24430101 missense probably benign 0.01
R4423:Slc4a2 UTSW 5 24439848 nonsense probably null
R4457:Slc4a2 UTSW 5 24434330 unclassified probably benign
R4678:Slc4a2 UTSW 5 24434240 critical splice donor site probably null
R4730:Slc4a2 UTSW 5 24434880 missense probably damaging 1.00
R4824:Slc4a2 UTSW 5 24440143 missense probably damaging 1.00
R4928:Slc4a2 UTSW 5 24435342 critical splice donor site probably null
R5071:Slc4a2 UTSW 5 24438762 missense probably benign
R5072:Slc4a2 UTSW 5 24438762 missense probably benign
R5073:Slc4a2 UTSW 5 24438762 missense probably benign
R5074:Slc4a2 UTSW 5 24438762 missense probably benign
R5108:Slc4a2 UTSW 5 24439333 missense probably damaging 1.00
R5135:Slc4a2 UTSW 5 24430127 missense possibly damaging 0.78
R5349:Slc4a2 UTSW 5 24435635 missense possibly damaging 0.74
R5601:Slc4a2 UTSW 5 24438774 missense probably benign 0.07
R5666:Slc4a2 UTSW 5 24434838 missense probably damaging 1.00
R5670:Slc4a2 UTSW 5 24434838 missense probably damaging 1.00
R6256:Slc4a2 UTSW 5 24435890 missense probably damaging 1.00
R6861:Slc4a2 UTSW 5 24435009 missense probably damaging 1.00
X0027:Slc4a2 UTSW 5 24435914 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TGAAGCTGCTGGAGAAGATC -3'
(R):5'- TGCCCAAGCAGATAGGGATC -3'

Sequencing Primer
(F):5'- ATCCCTGAGAATGCGGAGGC -3'
(R):5'- CTGGGAACTGGGGCAGGTAC -3'
Posted On2016-05-10