Incidental Mutation 'R4993:Nek9'
ID385040
Institutional Source Beutler Lab
Gene Symbol Nek9
Ensembl Gene ENSMUSG00000034290
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 9
SynonymsC130021H08Rik
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R4993 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85299514-85339362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85310420 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 657 (C657R)
Ref Sequence ENSEMBL: ENSMUSP00000049056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040992]
Predicted Effect probably damaging
Transcript: ENSMUST00000040992
AA Change: C657R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049056
Gene: ENSMUSG00000034290
AA Change: C657R

DomainStartEndE-ValueType
low complexity region 19 49 N/A INTRINSIC
S_TKc 52 308 1.07e-73 SMART
Pfam:RCC1 389 441 1.2e-9 PFAM
Pfam:RCC1_2 428 457 1.5e-8 PFAM
Pfam:RCC1 444 495 3.6e-13 PFAM
Pfam:RCC1_2 482 511 3.6e-11 PFAM
Pfam:RCC1 499 547 7.6e-14 PFAM
Pfam:RCC1 615 665 4.2e-8 PFAM
Pfam:RCC1_2 652 681 4.4e-7 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 910 927 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein is activated in mitosis and, in turn, activates other family members during mitosis. This protein also mediates cellular processes that are essential for interphase progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Nek9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Nek9 APN 12 85314587 missense probably benign 0.23
IGL01595:Nek9 APN 12 85314420 missense probably damaging 1.00
IGL01603:Nek9 APN 12 85305605 missense probably damaging 1.00
IGL01893:Nek9 APN 12 85336400 missense probably damaging 1.00
IGL02017:Nek9 APN 12 85329923 missense probably damaging 1.00
IGL02197:Nek9 APN 12 85307930 missense probably null
IGL02207:Nek9 APN 12 85303483 nonsense probably null
IGL02749:Nek9 APN 12 85305507 missense probably benign 0.02
IGL02756:Nek9 APN 12 85311336 critical splice donor site probably null
IGL03343:Nek9 APN 12 85303609 missense probably damaging 1.00
R0048:Nek9 UTSW 12 85301899 missense probably benign 0.17
R0331:Nek9 UTSW 12 85327375 splice site probably benign
R0499:Nek9 UTSW 12 85301883 missense probably benign 0.09
R1484:Nek9 UTSW 12 85301848 missense probably damaging 1.00
R1760:Nek9 UTSW 12 85305590 missense possibly damaging 0.71
R1760:Nek9 UTSW 12 85310410 missense probably benign 0.00
R1883:Nek9 UTSW 12 85332556 missense probably damaging 1.00
R1884:Nek9 UTSW 12 85332556 missense probably damaging 1.00
R1999:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2046:Nek9 UTSW 12 85320707 splice site probably benign
R2096:Nek9 UTSW 12 85314548 missense probably benign 0.00
R2150:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2368:Nek9 UTSW 12 85329887 missense possibly damaging 0.89
R2570:Nek9 UTSW 12 85332546 nonsense probably null
R4381:Nek9 UTSW 12 85329858 missense probably damaging 1.00
R4570:Nek9 UTSW 12 85320734 missense probably damaging 1.00
R4661:Nek9 UTSW 12 85320892 missense possibly damaging 0.78
R4669:Nek9 UTSW 12 85314204 missense probably benign 0.00
R5071:Nek9 UTSW 12 85327459 missense possibly damaging 0.70
R5090:Nek9 UTSW 12 85329842 critical splice donor site probably null
R5248:Nek9 UTSW 12 85308977 missense probably damaging 1.00
R5521:Nek9 UTSW 12 85327445 missense probably benign 0.09
R5734:Nek9 UTSW 12 85303515 missense probably benign
R6039:Nek9 UTSW 12 85313085 missense probably benign 0.08
R6039:Nek9 UTSW 12 85313085 missense probably benign 0.08
R6269:Nek9 UTSW 12 85332329 intron probably null
R6353:Nek9 UTSW 12 85301829 missense probably damaging 0.96
R6406:Nek9 UTSW 12 85339172 missense probably damaging 0.97
R6744:Nek9 UTSW 12 85329929 missense probably benign 0.09
R6922:Nek9 UTSW 12 85303537 missense probably damaging 1.00
X0052:Nek9 UTSW 12 85322027 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGAAGTGCTCAATGGTTGTG -3'
(R):5'- ATGGAGTGTGCTCTACCTTCC -3'

Sequencing Primer
(F):5'- CTCAATGGTTGTGGGAATATTTTACC -3'
(R):5'- CGTGTTTCATAACCCATTCGTGATTG -3'
Posted On2016-05-10