Incidental Mutation 'R4993:Tcf4'
ID385060
Institutional Source Beutler Lab
Gene Symbol Tcf4
Ensembl Gene ENSMUSG00000053477
Gene Nametranscription factor 4
SynonymsMITF-2B, ITF-2, MITF-2A, ME2, SEF2-1, 5730422P05Rik, ASP-I2, SEF-2, bHLHb19, TFE, E2.2, ITF-2b, E2-2
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4993 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location69343356-69689079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69681769 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 587 (V587A)
Ref Sequence ENSEMBL: ENSMUSP00000144221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066717] [ENSMUST00000078486] [ENSMUST00000114977] [ENSMUST00000114978] [ENSMUST00000114980] [ENSMUST00000114982] [ENSMUST00000114985] [ENSMUST00000201094] [ENSMUST00000201205] [ENSMUST00000201410] [ENSMUST00000201631] [ENSMUST00000201781] [ENSMUST00000202057] [ENSMUST00000202116] [ENSMUST00000202354] [ENSMUST00000202435] [ENSMUST00000202458] [ENSMUST00000202474] [ENSMUST00000202477] [ENSMUST00000202610] [ENSMUST00000202674] [ENSMUST00000202751] [ENSMUST00000202772] [ENSMUST00000202937]
Predicted Effect probably damaging
Transcript: ENSMUST00000066717
AA Change: V638A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067318
Gene: ENSMUSG00000053477
AA Change: V638A

DomainStartEndE-ValueType
low complexity region 244 252 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 488 501 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
HLH 595 648 3.57e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078486
AA Change: V616A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077577
Gene: ENSMUSG00000053477
AA Change: V616A

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
HLH 573 626 3.57e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114977
AA Change: V453A

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110628
Gene: ENSMUSG00000053477
AA Change: V453A

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
low complexity region 343 361 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
HLH 410 463 3.57e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114978
AA Change: V457A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110629
Gene: ENSMUSG00000053477
AA Change: V457A

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
low complexity region 343 361 N/A INTRINSIC
low complexity region 365 383 N/A INTRINSIC
HLH 414 467 3.57e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114980
AA Change: V616A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110631
Gene: ENSMUSG00000053477
AA Change: V616A

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114982
AA Change: V612A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110633
Gene: ENSMUSG00000053477
AA Change: V612A

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114985
AA Change: V616A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110636
Gene: ENSMUSG00000053477
AA Change: V616A

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
HLH 573 626 3.57e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146908
Predicted Effect probably damaging
Transcript: ENSMUST00000201094
AA Change: V483A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144169
Gene: ENSMUSG00000053477
AA Change: V483A

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201205
AA Change: V487A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144273
Gene: ENSMUSG00000053477
AA Change: V487A

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 413 N/A INTRINSIC
HLH 444 497 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201410
AA Change: V483A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143950
Gene: ENSMUSG00000053477
AA Change: V483A

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201631
AA Change: V588A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144285
Gene: ENSMUSG00000053477
AA Change: V588A

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 521 N/A INTRINSIC
HLH 545 598 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201781
AA Change: V592A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144209
Gene: ENSMUSG00000053477
AA Change: V592A

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
HLH 549 602 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202057
AA Change: V483A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144647
Gene: ENSMUSG00000053477
AA Change: V483A

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202116
AA Change: V612A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144512
Gene: ENSMUSG00000053477
AA Change: V612A

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202354
AA Change: V587A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144646
Gene: ENSMUSG00000053477
AA Change: V587A

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
low complexity region 477 495 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
HLH 544 597 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202435
AA Change: V592A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144407
Gene: ENSMUSG00000053477
AA Change: V592A

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
HLH 549 602 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202458
AA Change: V533A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143875
Gene: ENSMUSG00000053477
AA Change: V533A

DomainStartEndE-ValueType
low complexity region 143 151 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 387 400 N/A INTRINSIC
low complexity region 423 441 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
HLH 490 543 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202474
AA Change: V453A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143820
Gene: ENSMUSG00000053477
AA Change: V453A

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
low complexity region 343 361 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
HLH 410 463 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202477
AA Change: V483A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144219
Gene: ENSMUSG00000053477
AA Change: V483A

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202610
AA Change: V556A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144670
Gene: ENSMUSG00000053477
AA Change: V556A

DomainStartEndE-ValueType
low complexity region 162 170 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
low complexity region 442 460 N/A INTRINSIC
low complexity region 464 482 N/A INTRINSIC
HLH 513 566 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202674
AA Change: V587A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144221
Gene: ENSMUSG00000053477
AA Change: V587A

DomainStartEndE-ValueType
low complexity region 197 205 N/A INTRINSIC
low complexity region 311 322 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
low complexity region 477 495 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
HLH 544 597 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202751
SMART Domains Protein: ENSMUSP00000144064
Gene: ENSMUSG00000053477

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202772
AA Change: V552A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143987
Gene: ENSMUSG00000053477
AA Change: V552A

DomainStartEndE-ValueType
low complexity region 162 170 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
low complexity region 442 460 N/A INTRINSIC
low complexity region 464 485 N/A INTRINSIC
HLH 509 562 1.6e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202937
AA Change: V487A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143857
Gene: ENSMUSG00000053477
AA Change: V487A

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 413 N/A INTRINSIC
HLH 444 497 1.6e-13 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show a partial block in early thymopoiesis, increased double-negative T cell count, and increased sensitivity to anti-CD3 induced apoptosis. Homozygotes for another null allele show neonatal or postnatal lethality, reduced pro-B cell number, and abnormal pontine nuclei. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Tcf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Tcf4 APN 18 69655019 missense probably damaging 1.00
IGL02131:Tcf4 APN 18 69564626 splice site probably benign
IGL02221:Tcf4 APN 18 69347367 missense probably damaging 1.00
IGL02420:Tcf4 APN 18 69564139 missense probably damaging 1.00
IGL02560:Tcf4 APN 18 69643022 unclassified probably benign
IGL02637:Tcf4 APN 18 69347350 missense probably damaging 1.00
IGL03056:Tcf4 APN 18 69651212 splice site probably benign
R0374:Tcf4 UTSW 18 69681812 splice site probably benign
R1265:Tcf4 UTSW 18 69642932 missense possibly damaging 0.93
R1739:Tcf4 UTSW 18 69642970 missense probably damaging 1.00
R1794:Tcf4 UTSW 18 69657853 missense probably benign 0.44
R4703:Tcf4 UTSW 18 69657910 missense probably damaging 1.00
R4735:Tcf4 UTSW 18 69564155 missense possibly damaging 0.59
R5191:Tcf4 UTSW 18 69642883 missense probably damaging 1.00
R5318:Tcf4 UTSW 18 69465430 missense possibly damaging 0.90
R5634:Tcf4 UTSW 18 69636847 missense possibly damaging 0.88
R6337:Tcf4 UTSW 18 69633580 missense probably damaging 1.00
R6658:Tcf4 UTSW 18 69657802 missense probably null 1.00
R6868:Tcf4 UTSW 18 69657650 intron probably null
R6907:Tcf4 UTSW 18 69652413 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGTCTTGTTCCCCTTGC -3'
(R):5'- TGTCTGAGGATTGAGAACACAG -3'

Sequencing Primer
(F):5'- TAACGATGATGAGGACCTGACCC -3'
(R):5'- CAGATGGAAAAGCTGTAGCATGGC -3'
Posted On2016-05-10