Incidental Mutation 'R5390:Tctn2'
ID 500980
Institutional Source Beutler Lab
Gene Symbol Tctn2
Ensembl Gene ENSMUSG00000029386
Gene Name tectonic family member 2
Synonyms Tect2, 4432405B04Rik
MMRRC Submission 042962-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R5390 (G1)
Quality Score 113
Status Not validated
Chromosome 5
Chromosomal Location 124736812-124765803 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to ACC at 124762400 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000037865
SMART Domains Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 842 3.3e-299 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100706
SMART Domains Protein: ENSMUSP00000098272
Gene: ENSMUSG00000029386

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:DUF1619 171 442 6.8e-75 PFAM
low complexity region 669 681 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130912
SMART Domains Protein: ENSMUSP00000114298
Gene: ENSMUSG00000029386

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:DUF1619 171 442 1.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197931
Predicted Effect probably benign
Transcript: ENSMUST00000198382
SMART Domains Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:V_ATPase_I 26 178 1.5e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200292
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein that belongs to the tectonic family. Studies in mice suggest that this protein may be involved in hedgehog signaling, and essential for ciliogenesis. Mutations in this gene are associated with Meckel syndrome type 8. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit open neural tubes, exencephaly, micropthalmia, cleft palate, preaxial polydactyly, ventricular septal defect, sight-sided stomach, absent floor plate, and cilia defects. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,406,772 (GRCm39) probably benign Het
Anxa4 G A 6: 86,730,865 (GRCm39) T104M probably damaging Het
BC048562 G T 9: 108,313,777 (GRCm39) W9L probably damaging Het
Cachd1 T A 4: 100,838,203 (GRCm39) M822K probably damaging Het
Clec4g C A 8: 3,768,441 (GRCm39) V97L probably benign Het
Ddx19a G A 8: 111,707,263 (GRCm39) Q176* probably null Het
Eml6 T C 11: 29,710,096 (GRCm39) H1413R probably damaging Het
Fam161b C T 12: 84,395,408 (GRCm39) V512M probably damaging Het
Glcci1 A T 6: 8,537,835 (GRCm39) Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,494,151 (GRCm39) probably benign Het
Gpnmb A T 6: 49,024,775 (GRCm39) D269V probably damaging Het
Gpx3 A T 11: 54,800,375 (GRCm39) D191V probably damaging Het
Grm4 C T 17: 27,653,712 (GRCm39) C491Y probably damaging Het
H2-M10.4 T A 17: 36,771,533 (GRCm39) H215L probably damaging Het
Hrc T A 7: 44,984,909 (GRCm39) L20Q probably damaging Het
Hsd17b6 T A 10: 127,827,308 (GRCm39) M255L probably benign Het
Hydin A T 8: 111,322,099 (GRCm39) I4584L probably benign Het
Ift70a2 A T 2: 75,807,630 (GRCm39) L294Q probably damaging Het
Ints5 T A 19: 8,873,931 (GRCm39) I630K possibly damaging Het
Kctd10 A G 5: 114,503,764 (GRCm39) I296T possibly damaging Het
Ltv1 G A 10: 13,058,103 (GRCm39) R234C probably damaging Het
Macf1 A G 4: 123,365,546 (GRCm39) S1507P probably damaging Het
Megf8 G A 7: 25,039,714 (GRCm39) G936D possibly damaging Het
Ms4a4d T C 19: 11,526,004 (GRCm39) probably null Het
Net1 C T 13: 3,943,379 (GRCm39) A3T probably benign Het
Nlrp2 T C 7: 5,303,908 (GRCm39) M206V probably benign Het
Or1j1 C T 2: 36,702,444 (GRCm39) R220H probably benign Het
Or5an1b T A 19: 12,299,505 (GRCm39) I229F probably damaging Het
Pcyox1l T C 18: 61,832,433 (GRCm39) I205V probably benign Het
Pigo A G 4: 43,019,645 (GRCm39) probably null Het
Pla2g6 A T 15: 79,173,893 (GRCm39) S590T possibly damaging Het
Pwp2 T C 10: 78,013,605 (GRCm39) T539A possibly damaging Het
Rag1 T C 2: 101,473,079 (GRCm39) T688A probably benign Het
Senp7 A G 16: 55,990,279 (GRCm39) T676A probably benign Het
Slc26a6 T C 9: 108,738,499 (GRCm39) probably benign Het
Slc45a2 C T 15: 11,027,871 (GRCm39) T480I probably damaging Het
Sorbs2 A G 8: 46,272,778 (GRCm39) H653R probably damaging Het
Stk3 T A 15: 35,114,706 (GRCm39) K67* probably null Het
Ttn T C 2: 76,540,395 (GRCm39) Y34197C probably damaging Het
Ufc1 A C 1: 171,117,746 (GRCm39) L56R probably damaging Het
Usp34 T A 11: 23,394,202 (GRCm39) probably null Het
Vnn3 T A 10: 23,727,483 (GRCm39) M1K probably null Het
Zfp653 C A 9: 21,969,099 (GRCm39) probably null Het
Other mutations in Tctn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Tctn2 APN 5 124,754,591 (GRCm39) exon noncoding transcript
IGL02154:Tctn2 APN 5 124,746,624 (GRCm39) exon noncoding transcript
IGL02447:Tctn2 APN 5 124,753,316 (GRCm39) exon noncoding transcript
3-1:Tctn2 UTSW 5 124,753,294 (GRCm39) exon noncoding transcript
R0101:Tctn2 UTSW 5 124,753,357 (GRCm39) splice site noncoding transcript
R0101:Tctn2 UTSW 5 124,753,357 (GRCm39) splice site noncoding transcript
R1481:Tctn2 UTSW 5 124,745,826 (GRCm39) exon noncoding transcript
R1764:Tctn2 UTSW 5 124,757,094 (GRCm39) splice site noncoding transcript
R1865:Tctn2 UTSW 5 124,757,143 (GRCm39) exon noncoding transcript
R4467:Tctn2 UTSW 5 124,758,252 (GRCm39) exon noncoding transcript
R5884:Tctn2 UTSW 5 124,741,895 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTCTGCCTGTAGACGCTGTG -3'
(R):5'- AACAATCGCCATTTGCAAGCG -3'

Sequencing Primer
(F):5'- GAGAGCCAGACCATATCA -3'
(R):5'- AAGCGTGCAGATTCCAGCCTAG -3'
Posted On 2017-12-01