Incidental Mutation 'R5390:Tctn2'
ID500980
Institutional Source Beutler Lab
Gene Symbol Tctn2
Ensembl Gene ENSMUSG00000029386
Gene Nametectonic family member 2
SynonymsTect2, 4432405B04Rik
MMRRC Submission 042962-MU
Accession Numbers

Genbank: NM_026486; MGI: 1915228

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5390 (G1)
Quality Score113
Status Not validated
Chromosome5
Chromosomal Location124598749-124628771 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to ACC at 124624335 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]
Predicted Effect probably benign
Transcript: ENSMUST00000037865
SMART Domains Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 842 3.3e-299 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100706
SMART Domains Protein: ENSMUSP00000098272
Gene: ENSMUSG00000029386

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:DUF1619 171 442 6.8e-75 PFAM
low complexity region 669 681 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130912
SMART Domains Protein: ENSMUSP00000114298
Gene: ENSMUSG00000029386

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:DUF1619 171 442 1.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197931
Predicted Effect probably benign
Transcript: ENSMUST00000198382
SMART Domains Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:V_ATPase_I 26 178 1.5e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200292
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein that belongs to the tectonic family. Studies in mice suggest that this protein may be involved in hedgehog signaling, and essential for ciliogenesis. Mutations in this gene are associated with Meckel syndrome type 8. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit open neural tubes, exencephaly, micropthalmia, cleft palate, preaxial polydactyly, ventricular septal defect, sight-sided stomach, absent floor plate, and cilia defects. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Tctn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Tctn2 APN 5 124616528 exon noncoding transcript
IGL02154:Tctn2 APN 5 124608561 exon noncoding transcript
IGL02447:Tctn2 APN 5 124615253 exon noncoding transcript
3-1:Tctn2 UTSW 5 124615231 exon noncoding transcript
R0101:Tctn2 UTSW 5 124615294 splice site noncoding transcript
R0101:Tctn2 UTSW 5 124615294 splice site noncoding transcript
R1481:Tctn2 UTSW 5 124607763 exon noncoding transcript
R1764:Tctn2 UTSW 5 124619031 splice site noncoding transcript
R1865:Tctn2 UTSW 5 124619080 exon noncoding transcript
R4467:Tctn2 UTSW 5 124620189 exon noncoding transcript
R5884:Tctn2 UTSW 5 124603832 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTCTGCCTGTAGACGCTGTG -3'
(R):5'- AACAATCGCCATTTGCAAGCG -3'

Sequencing Primer
(F):5'- GAGAGCCAGACCATATCA -3'
(R):5'- AAGCGTGCAGATTCCAGCCTAG -3'
Posted On2017-12-01