Incidental Mutation 'R7026:Ints4'
ID545957
Institutional Source Beutler Lab
Gene Symbol Ints4
Ensembl Gene ENSMUSG00000025133
Gene Nameintegrator complex subunit 4
Synonyms2610034N24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7026 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location97480956-97541395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97519154 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 625 (V625D)
Ref Sequence ENSEMBL: ENSMUSP00000026126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026126]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026126
AA Change: V625D

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026126
Gene: ENSMUSG00000025133
AA Change: V625D

DomainStartEndE-ValueType
Pfam:HEAT_2 153 258 9.8e-9 PFAM
Pfam:Cohesin_HEAT 179 219 7.7e-6 PFAM
low complexity region 518 527 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS4 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Ints4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Ints4 APN 7 97535205 missense probably damaging 1.00
IGL01736:Ints4 APN 7 97526642 missense probably benign 0.01
IGL01862:Ints4 APN 7 97541153 missense probably damaging 1.00
IGL02277:Ints4 APN 7 97487458 missense probably damaging 1.00
IGL02396:Ints4 APN 7 97537900 missense possibly damaging 0.64
IGL02661:Ints4 APN 7 97495705 missense probably benign
IGL02750:Ints4 APN 7 97517757 critical splice donor site probably null
IGL03108:Ints4 APN 7 97490930 critical splice acceptor site probably null
R0332:Ints4 UTSW 7 97517718 missense probably damaging 1.00
R0449:Ints4 UTSW 7 97529223 missense probably damaging 0.97
R1065:Ints4 UTSW 7 97507892 critical splice donor site probably null
R1722:Ints4 UTSW 7 97513579 missense probably benign 0.24
R2060:Ints4 UTSW 7 97501763 missense possibly damaging 0.93
R2211:Ints4 UTSW 7 97509750 missense possibly damaging 0.63
R3731:Ints4 UTSW 7 97506101 missense probably benign 0.18
R3881:Ints4 UTSW 7 97516257 missense possibly damaging 0.94
R4089:Ints4 UTSW 7 97529255 nonsense probably null
R4192:Ints4 UTSW 7 97507733 missense probably damaging 1.00
R4479:Ints4 UTSW 7 97484971 missense probably damaging 1.00
R4980:Ints4 UTSW 7 97501850 critical splice donor site probably null
R5029:Ints4 UTSW 7 97509774 missense probably benign 0.06
R5306:Ints4 UTSW 7 97509678 missense probably damaging 1.00
R6160:Ints4 UTSW 7 97509583 splice site probably null
R6317:Ints4 UTSW 7 97529218 nonsense probably null
R6961:Ints4 UTSW 7 97541190 makesense probably null
R7156:Ints4 UTSW 7 97535286 critical splice donor site probably null
R7205:Ints4 UTSW 7 97535226 nonsense probably null
R7234:Ints4 UTSW 7 97530300 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGGGTCATGCTAGCATTCTC -3'
(R):5'- TGACTCATGAATGCAAACAGC -3'

Sequencing Primer
(F):5'- CTCTGTGCATCTGAGAGAGAG -3'
(R):5'- GCATGAGAGAATGCTAGC -3'
Posted On2019-05-13