Incidental Mutation 'R1187:Sri'
ID102236
Institutional Source Beutler Lab
Gene Symbol Sri
Ensembl Gene ENSMUSG00000003161
Gene Namesorcin
SynonymsSor, 2210417O06Rik, 2900070H08Rik
MMRRC Submission 039259-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R1187 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8046078-8069379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8059416 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 52 (Y52H)
Ref Sequence ENSEMBL: ENSMUSP00000086165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088786] [ENSMUST00000148633]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000003245
Predicted Effect probably damaging
Transcript: ENSMUST00000088786
AA Change: Y52H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086165
Gene: ENSMUSG00000003161
AA Change: Y52H

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EF-hand_5 30 43 8.7e-4 PFAM
EFh 59 87 6.75e0 SMART
EFh 89 117 1.02e-2 SMART
Blast:EFh 153 183 9e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145119
Predicted Effect probably damaging
Transcript: ENSMUST00000148633
AA Change: Y67H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118221
Gene: ENSMUSG00000003161
AA Change: Y67H

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
Pfam:EF-hand_5 45 58 9.6e-4 PFAM
EFh 74 102 6.75e0 SMART
EFh 104 132 1.02e-2 SMART
Blast:EFh 168 198 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197065
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,528,981 M4276I probably benign Het
Apol7b A T 15: 77,423,403 F297L possibly damaging Het
C330027C09Rik T A 16: 49,000,293 N132K probably damaging Het
Capsl C T 15: 9,457,721 R9W probably damaging Het
Catsperb T C 12: 101,625,732 V1107A probably benign Het
Clca1 T C 3: 145,009,743 I544M probably benign Het
Cma2 T C 14: 55,972,823 V55A probably benign Het
Col10a1 A T 10: 34,394,838 I269F probably benign Het
Col26a1 G A 5: 136,744,166 H385Y probably damaging Het
Ctdp1 A G 18: 80,449,487 Y598H probably damaging Het
Dnajc1 A G 2: 18,284,709 S296P probably benign Het
Dvl2 A T 11: 70,006,136 T250S probably benign Het
Etv1 A G 12: 38,865,564 Y410C probably damaging Het
Gm38394 G A 1: 133,659,203 T132I probably damaging Het
Krcc1 A T 6: 71,284,628 K215* probably null Het
Lrr1 A T 12: 69,175,022 T313S probably benign Het
Lrrc7 T A 3: 158,160,402 E1234V probably damaging Het
Mepe G A 5: 104,338,248 R418H probably damaging Het
Myrfl G A 10: 116,831,542 T331I probably damaging Het
Nbeal1 T C 1: 60,194,528 W26R probably damaging Het
Nsrp1 G A 11: 77,046,027 P448S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfml2a A G 2: 38,959,813 N514D probably damaging Het
Olfr1390 T G 11: 49,340,590 D19E probably damaging Het
Olfr167 T C 16: 19,515,046 T197A probably benign Het
Pcdhb1 C T 18: 37,265,544 R183C probably damaging Het
Phf14 T G 6: 11,941,496 C41G probably damaging Het
Pkhd1l1 T C 15: 44,498,051 V499A possibly damaging Het
Plcb4 A G 2: 135,968,394 I638V probably benign Het
Ppp4c T A 7: 126,786,200 I296F probably benign Het
Prkdc T C 16: 15,759,746 V2388A probably damaging Het
Rgl1 T C 1: 152,544,433 D353G probably benign Het
Rnf19b T G 4: 129,075,567 probably null Het
Ryr3 C T 2: 112,958,176 D190N probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e G A 5: 14,232,084 M411I probably damaging Het
Sgsh A T 11: 119,346,578 Y403* probably null Het
Sh2d7 T A 9: 54,541,187 L164Q probably benign Het
Slfn8 A T 11: 83,003,488 V775E probably damaging Het
Smgc G A 15: 91,860,600 G287S probably damaging Het
Soat1 T A 1: 156,434,175 Y421F probably damaging Het
Stat4 C A 1: 52,076,677 Q259K probably damaging Het
Trpm5 A G 7: 143,074,469 L1023P probably damaging Het
Ush1c T A 7: 46,208,914 N650I probably benign Het
Vmn2r8 G T 5: 108,803,219 S120* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp629 A G 7: 127,610,229 S803P probably benign Het
Zfp629 T C 7: 127,611,887 K250R probably damaging Het
Zfp758 T A 17: 22,375,190 I187N probably benign Het
Zfp85 T A 13: 67,749,716 K79I probably damaging Het
Other mutations in Sri
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Sri APN 5 8063755 splice site probably null
IGL02442:Sri APN 5 8062411 missense probably damaging 1.00
IGL02661:Sri APN 5 8063252 splice site probably benign
IGL02675:Sri APN 5 8067534 missense probably damaging 1.00
R0847:Sri UTSW 5 8063755 splice site probably null
R0973:Sri UTSW 5 8059381 missense probably damaging 1.00
R0973:Sri UTSW 5 8059381 missense probably damaging 1.00
R0974:Sri UTSW 5 8059381 missense probably damaging 1.00
R2860:Sri UTSW 5 8067540 missense probably benign 0.26
R2861:Sri UTSW 5 8067540 missense probably benign 0.26
R3844:Sri UTSW 5 8064576 missense probably damaging 1.00
R4345:Sri UTSW 5 8059427 splice site probably null
R4575:Sri UTSW 5 8063693 missense probably damaging 1.00
R4704:Sri UTSW 5 8062430 splice site probably null
R5878:Sri UTSW 5 8059353 missense probably damaging 1.00
R6257:Sri UTSW 5 8059596 splice site probably null
R6944:Sri UTSW 5 8063365 missense probably benign 0.09
R7716:Sri UTSW 5 8056641 critical splice donor site probably null
R7917:Sri UTSW 5 8063409 critical splice donor site probably null
R7929:Sri UTSW 5 8057652 intron probably benign
R7960:Sri UTSW 5 8064586 missense probably benign 0.04
R8316:Sri UTSW 5 8063317 missense probably damaging 0.96
X0061:Sri UTSW 5 8063368 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCCTTGGCTCAAACTGAATGCAGAC -3'
(R):5'- TCTCACTGGTTCCAATGGTCCTGG -3'

Sequencing Primer
(F):5'- CTCAAACTGAATGCAGACTGTTGTC -3'
(R):5'- GTTCCAATGGTCCTGGAATACAAG -3'
Posted On2014-01-15