Incidental Mutation 'R1280:Vps54'
ID151007
Institutional Source Beutler Lab
Gene Symbol Vps54
Ensembl Gene ENSMUSG00000020128
Gene NameVPS54 GARP complex subunit
Synonyms5330404P15Rik, wr, mSLP8, Vps54l
MMRRC Submission 039346-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R1280 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location21239281-21321136 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21277868 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 273 (I273N)
Ref Sequence ENSEMBL: ENSMUSP00000006221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006221] [ENSMUST00000109578] [ENSMUST00000132017]
PDB Structure
C-terminal domain of Vps54 subunit of the GARP complex [X-RAY DIFFRACTION]
Vps54 C-terminal domain [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006221
AA Change: I273N

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006221
Gene: ENSMUSG00000020128
AA Change: I273N

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:DUF2450 198 364 2.1e-12 PFAM
Pfam:Vps54 736 868 3.3e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109578
AA Change: I261N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105206
Gene: ENSMUSG00000020128
AA Change: I261N

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:DUF2450 186 352 2.3e-12 PFAM
Pfam:Vps54 723 857 1.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118219
Predicted Effect possibly damaging
Transcript: ENSMUST00000132017
AA Change: I147N

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116739
Gene: ENSMUSG00000020128
AA Change: I147N

DomainStartEndE-ValueType
Pfam:DUF2450 72 238 1.4e-12 PFAM
Pfam:Vps54 573 707 7.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132146
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes for a protein that in yeast forms part of a trimeric vacuolar-protein-sorting complex that is required for retrograde transport of proteins from prevacuoles to the late Golgi compartment. As in yeast, mammalian Vps54 proteins contain a coiled-coil region and dileucine motifs. Alternative splicing results in multiple transcript variants encoding different isoforms [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show progressive ataxia, tremors, and limb paralysis with degeneration of motor nerve cells of brainstem and spinal cord and atrophy of skeletal muscle beginning about 3-weeks of age. Mutants are sterile and most die by 3-months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp5g3 G T 2: 73,909,370 T42K possibly damaging Het
Brd2 T C 17: 34,114,150 M60V possibly damaging Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Cers6 G A 2: 69,068,689 V224I probably benign Het
Entpd2 C T 2: 25,399,484 S326F probably damaging Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Myo18b A G 5: 112,723,805 probably null Het
Mzf1 A T 7: 13,053,083 L20Q probably damaging Het
Neil1 T C 9: 57,146,901 Y45C probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Rbm12 T C 2: 156,096,829 K508E probably damaging Het
Socs4 A T 14: 47,290,913 Q435L probably benign Het
Tdrd9 T C 12: 112,039,408 V905A probably damaging Het
Tekt4 T A 17: 25,471,887 W56R probably damaging Het
Ttn A T 2: 76,778,164 I16059N possibly damaging Het
Ubqln3 A G 7: 104,142,076 V269A possibly damaging Het
Zfp831 A G 2: 174,704,059 K1319R probably benign Het
Other mutations in Vps54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Vps54 APN 11 21277909 missense possibly damaging 0.74
IGL01070:Vps54 APN 11 21312268 missense probably damaging 1.00
IGL01398:Vps54 APN 11 21295403 splice site probably benign
IGL01450:Vps54 APN 11 21291135 missense probably benign 0.00
IGL01611:Vps54 APN 11 21311082 missense probably damaging 1.00
IGL01801:Vps54 APN 11 21275131 critical splice donor site probably null
IGL01872:Vps54 APN 11 21306940 missense probably damaging 0.99
IGL02071:Vps54 APN 11 21275071 missense probably null 0.00
IGL02186:Vps54 APN 11 21306947 missense probably damaging 1.00
IGL03358:Vps54 APN 11 21268799 missense probably damaging 1.00
R0031:Vps54 UTSW 11 21312899 missense probably damaging 1.00
R0147:Vps54 UTSW 11 21300259 missense probably benign 0.02
R0158:Vps54 UTSW 11 21306962 missense probably damaging 1.00
R0385:Vps54 UTSW 11 21306381 missense possibly damaging 0.94
R0420:Vps54 UTSW 11 21311071 splice site probably benign
R0582:Vps54 UTSW 11 21300137 missense probably damaging 1.00
R0602:Vps54 UTSW 11 21306434 missense possibly damaging 0.92
R1051:Vps54 UTSW 11 21278001 frame shift probably null
R1720:Vps54 UTSW 11 21306519 missense probably damaging 1.00
R1875:Vps54 UTSW 11 21300251 missense probably benign 0.00
R1883:Vps54 UTSW 11 21312967 missense possibly damaging 0.91
R1971:Vps54 UTSW 11 21292051 missense probably damaging 1.00
R2063:Vps54 UTSW 11 21277955 missense probably damaging 1.00
R2171:Vps54 UTSW 11 21298810 missense probably benign 0.16
R2518:Vps54 UTSW 11 21306394 missense probably benign 0.01
R3801:Vps54 UTSW 11 21268832 missense probably benign 0.00
R4049:Vps54 UTSW 11 21300183 missense probably benign 0.00
R4108:Vps54 UTSW 11 21312877 missense probably benign 0.02
R4560:Vps54 UTSW 11 21312260 missense possibly damaging 0.91
R4668:Vps54 UTSW 11 21299989 missense probably benign 0.04
R4772:Vps54 UTSW 11 21312952 missense probably damaging 1.00
R5061:Vps54 UTSW 11 21319881 utr 3 prime probably benign
R5611:Vps54 UTSW 11 21311130 missense possibly damaging 0.65
R5638:Vps54 UTSW 11 21308799 missense probably damaging 1.00
R5670:Vps54 UTSW 11 21264864 missense probably damaging 1.00
R7095:Vps54 UTSW 11 21271720 missense probably benign 0.12
R7175:Vps54 UTSW 11 21315028 critical splice donor site probably null
R7179:Vps54 UTSW 11 21298791 missense probably damaging 1.00
R7269:Vps54 UTSW 11 21277670 splice site probably null
R7286:Vps54 UTSW 11 21275005 missense probably benign 0.30
R7344:Vps54 UTSW 11 21274999 missense probably damaging 1.00
R7552:Vps54 UTSW 11 21298831 missense probably benign 0.08
R7897:Vps54 UTSW 11 21263307 missense probably benign 0.02
R7980:Vps54 UTSW 11 21263307 missense probably benign 0.02
R8011:Vps54 UTSW 11 21275095 missense probably damaging 0.99
Z1177:Vps54 UTSW 11 21263206 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GAGGCTGTTACCTTTGGGGAAGAAG -3'
(R):5'- AGACATACCGGAAGCTGTGAATGC -3'

Sequencing Primer
(F):5'- GTAAGTGAACATGTCTCCTTTGCAC -3'
(R):5'- TGTGAATGCCCTGAAGCTC -3'
Posted On2014-01-29