Mutagenetix > Incidental Mutations

Incidental Mutation 'R1280:Vps54'

151007

Institutional Source

Beutler Lab

Gene Symbol

Vps54

Ensembl Gene

ENSMUSG00000020128

Gene Name

VPS54 GARP complex subunit

Synonyms

5330404P15Rik, wr, mSLP8, Vps54l

MMRRC Submission

039346-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.939) question?

Stock #

R1280 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21239281-21321136 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21277868 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 273 (I273N)

Ref Sequence

ENSEMBL: ENSMUSP00000006221 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006221] [ENSMUST00000109578] [ENSMUST00000132017]

PDB Structure

C-terminal domain of Vps54 subunit of the GARP complex [X-RAY DIFFRACTION]
Vps54 C-terminal domain [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006221
AA Change: I273N

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000006221
Gene: ENSMUSG00000020128
AA Change: I273N

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
Pfam:DUF2450	198	364	2.1e-12	PFAM
Pfam:Vps54	736	868	3.3e-56	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109578
AA Change: I261N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000105206
Gene: ENSMUSG00000020128
AA Change: I261N

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
Pfam:DUF2450	186	352	2.3e-12	PFAM
Pfam:Vps54	723	857	1.6e-63	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118219

Predicted Effect

possibly damaging
Transcript: ENSMUST00000132017
AA Change: I147N

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000116739
Gene: ENSMUSG00000020128
AA Change: I147N

Domain	Start	End	E-Value	Type
Pfam:DUF2450	72	238	1.4e-12	PFAM
Pfam:Vps54	573	707	7.8e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132146

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.1%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes for a protein that in yeast forms part of a trimeric vacuolar-protein-sorting complex that is required for retrograde transport of proteins from prevacuoles to the late Golgi compartment. As in yeast, mammalian Vps54 proteins contain a coiled-coil region and dileucine motifs. Alternative splicing results in multiple transcript variants encoding different isoforms [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show progressive ataxia, tremors, and limb paralysis with degeneration of motor nerve cells of brainstem and spinal cord and atrophy of skeletal muscle beginning about 3-weeks of age. Mutants are sterile and most die by 3-months of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Atp5g3	G	T	2: 73,909,370	T42K	possibly damaging	Het
Brd2	T	C	17: 34,114,150	M60V	possibly damaging	Het
Cabp1	T	C	5: 115,175,471	N226S	probably benign	Het
Cers6	G	A	2: 69,068,689	V224I	probably benign	Het
Entpd2	C	T	2: 25,399,484	S326F	probably damaging	Het
Fez1	GACAAACA	GACA	9: 36,870,549		probably null	Het
Gjb3	G	A	4: 127,326,431	R103W	probably damaging	Het
Klhdc7a	G	A	4: 139,965,453	R728C	probably benign	Het
Myo18b	A	G	5: 112,723,805		probably null	Het
Mzf1	A	T	7: 13,053,083	L20Q	probably damaging	Het
Neil1	T	C	9: 57,146,901	Y45C	probably damaging	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Rbm12	T	C	2: 156,096,829	K508E	probably damaging	Het
Socs4	A	T	14: 47,290,913	Q435L	probably benign	Het
Tdrd9	T	C	12: 112,039,408	V905A	probably damaging	Het
Tekt4	T	A	17: 25,471,887	W56R	probably damaging	Het
Ttn	A	T	2: 76,778,164	I16059N	possibly damaging	Het
Ubqln3	A	G	7: 104,142,076	V269A	possibly damaging	Het
Zfp831	A	G	2: 174,704,059	K1319R	probably benign	Het

Other mutations in Vps54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Vps54	APN	11	21277909	missense	possibly damaging	0.74
IGL01070:Vps54	APN	11	21312268	missense	probably damaging	1.00
IGL01398:Vps54	APN	11	21295403	splice site	probably benign
IGL01450:Vps54	APN	11	21291135	missense	probably benign	0.00
IGL01611:Vps54	APN	11	21311082	missense	probably damaging	1.00
IGL01801:Vps54	APN	11	21275131	critical splice donor site	probably null
IGL01872:Vps54	APN	11	21306940	missense	probably damaging	0.99
IGL02071:Vps54	APN	11	21275071	missense	probably null	0.00
IGL02186:Vps54	APN	11	21306947	missense	probably damaging	1.00
IGL03358:Vps54	APN	11	21268799	missense	probably damaging	1.00
muddle	UTSW	11	21277670	splice site	probably null
R0031:Vps54	UTSW	11	21312899	missense	probably damaging	1.00
R0147:Vps54	UTSW	11	21300259	missense	probably benign	0.02
R0158:Vps54	UTSW	11	21306962	missense	probably damaging	1.00
R0385:Vps54	UTSW	11	21306381	missense	possibly damaging	0.94
R0420:Vps54	UTSW	11	21311071	splice site	probably benign
R0582:Vps54	UTSW	11	21300137	missense	probably damaging	1.00
R0602:Vps54	UTSW	11	21306434	missense	possibly damaging	0.92
R1051:Vps54	UTSW	11	21278001	frame shift	probably null
R1720:Vps54	UTSW	11	21306519	missense	probably damaging	1.00
R1875:Vps54	UTSW	11	21300251	missense	probably benign	0.00
R1883:Vps54	UTSW	11	21312967	missense	possibly damaging	0.91
R1971:Vps54	UTSW	11	21292051	missense	probably damaging	1.00
R2063:Vps54	UTSW	11	21277955	missense	probably damaging	1.00
R2171:Vps54	UTSW	11	21298810	missense	probably benign	0.16
R2518:Vps54	UTSW	11	21306394	missense	probably benign	0.01
R3801:Vps54	UTSW	11	21268832	missense	probably benign	0.00
R4049:Vps54	UTSW	11	21300183	missense	probably benign	0.00
R4108:Vps54	UTSW	11	21312877	missense	probably benign	0.02
R4560:Vps54	UTSW	11	21312260	missense	possibly damaging	0.91
R4668:Vps54	UTSW	11	21299989	missense	probably benign	0.04
R4772:Vps54	UTSW	11	21312952	missense	probably damaging	1.00
R5061:Vps54	UTSW	11	21319881	utr 3 prime	probably benign
R5611:Vps54	UTSW	11	21311130	missense	possibly damaging	0.65
R5638:Vps54	UTSW	11	21308799	missense	probably damaging	1.00
R5670:Vps54	UTSW	11	21264864	missense	probably damaging	1.00
R7095:Vps54	UTSW	11	21271720	missense	probably benign	0.12
R7175:Vps54	UTSW	11	21315028	critical splice donor site	probably null
R7179:Vps54	UTSW	11	21298791	missense	probably damaging	1.00
R7269:Vps54	UTSW	11	21277670	splice site	probably null
R7286:Vps54	UTSW	11	21275005	missense	probably benign	0.30
R7344:Vps54	UTSW	11	21274999	missense	probably damaging	1.00
R7552:Vps54	UTSW	11	21298831	missense	probably benign	0.08
R7897:Vps54	UTSW	11	21263307	missense	probably benign	0.02
R8011:Vps54	UTSW	11	21275095	missense	probably damaging	0.99
R8193:Vps54	UTSW	11	21292045	missense	probably benign	0.00
R8282:Vps54	UTSW	11	21300464	intron	probably benign
R8534:Vps54	UTSW	11	21277706	missense	probably benign	0.05
R8559:Vps54	UTSW	11	21264815	missense	probably damaging	1.00
Z1177:Vps54	UTSW	11	21263206	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GAGGCTGTTACCTTTGGGGAAGAAG -3'
(R):5'- AGACATACCGGAAGCTGTGAATGC -3'

Sequencing Primer
(F):5'- GTAAGTGAACATGTCTCCTTTGCAC -3'
(R):5'- TGTGAATGCCCTGAAGCTC -3'

Posted On

2014-01-29