Incidental Mutation 'R1256:Pcdhb9'
ID151476
Institutional Source Beutler Lab
Gene Symbol Pcdhb9
Ensembl Gene ENSMUSG00000051242
Gene Nameprotocadherin beta 9
SynonymsPcdhbI, Pcdhb4C
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37400855-37403909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37403116 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 721 (D721G)
Ref Sequence ENSEMBL: ENSMUSP00000058801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057228] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057228
AA Change: D721G

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058801
Gene: ENSMUSG00000051242
AA Change: D721G

DomainStartEndE-ValueType
Pfam:Cadherin_2 65 147 2.3e-33 PFAM
CA 190 275 1.28e-17 SMART
CA 299 380 7.6e-25 SMART
CA 403 484 5.81e-21 SMART
CA 508 594 9.8e-28 SMART
CA 624 705 1.86e-10 SMART
Pfam:Cadherin_C_2 722 805 2.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Pcdhb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pcdhb9 APN 18 37403279 missense possibly damaging 0.59
IGL01557:Pcdhb9 APN 18 37403047 missense probably damaging 1.00
IGL01716:Pcdhb9 APN 18 37403175 missense probably damaging 0.99
IGL01954:Pcdhb9 APN 18 37401741 missense probably damaging 1.00
IGL02063:Pcdhb9 APN 18 37401757 missense probably benign 0.21
IGL03057:Pcdhb9 APN 18 37401277 missense probably benign 0.00
R0140:Pcdhb9 UTSW 18 37402961 missense possibly damaging 0.89
R0180:Pcdhb9 UTSW 18 37402254 missense probably damaging 1.00
R0349:Pcdhb9 UTSW 18 37402579 missense probably damaging 0.99
R0616:Pcdhb9 UTSW 18 37401975 nonsense probably null
R0669:Pcdhb9 UTSW 18 37402255 missense probably damaging 1.00
R1642:Pcdhb9 UTSW 18 37400934 intron probably benign
R1678:Pcdhb9 UTSW 18 37401629 missense probably damaging 1.00
R1711:Pcdhb9 UTSW 18 37403327 nonsense probably null
R1762:Pcdhb9 UTSW 18 37403083 missense probably benign 0.00
R1823:Pcdhb9 UTSW 18 37402818 missense probably benign 0.14
R1868:Pcdhb9 UTSW 18 37402084 missense probably damaging 1.00
R1959:Pcdhb9 UTSW 18 37403316 missense probably damaging 1.00
R2446:Pcdhb9 UTSW 18 37403287 missense probably damaging 0.99
R2889:Pcdhb9 UTSW 18 37403223 missense probably benign 0.06
R2890:Pcdhb9 UTSW 18 37403326 missense probably benign 0.23
R3196:Pcdhb9 UTSW 18 37401610 missense probably benign 0.02
R3725:Pcdhb9 UTSW 18 37401601 missense possibly damaging 0.95
R3726:Pcdhb9 UTSW 18 37401601 missense possibly damaging 0.95
R4179:Pcdhb9 UTSW 18 37401115 missense probably benign 0.17
R4326:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4326:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4327:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4327:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4329:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4329:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4626:Pcdhb9 UTSW 18 37402249 missense probably benign 0.01
R4738:Pcdhb9 UTSW 18 37403415 missense probably benign 0.33
R4888:Pcdhb9 UTSW 18 37403233 missense probably benign 0.22
R5140:Pcdhb9 UTSW 18 37401133 missense probably benign 0.00
R5186:Pcdhb9 UTSW 18 37401232 missense probably damaging 1.00
R5502:Pcdhb9 UTSW 18 37401603 missense possibly damaging 0.95
R5586:Pcdhb9 UTSW 18 37401114 missense probably benign
R5601:Pcdhb9 UTSW 18 37402206 missense probably damaging 1.00
R5624:Pcdhb9 UTSW 18 37401406 missense probably benign
R5827:Pcdhb9 UTSW 18 37401958 missense possibly damaging 0.72
R5829:Pcdhb9 UTSW 18 37401889 missense probably damaging 0.97
R5837:Pcdhb9 UTSW 18 37402798 missense probably damaging 1.00
R6147:Pcdhb9 UTSW 18 37402441 missense possibly damaging 0.95
R6228:Pcdhb9 UTSW 18 37402062 missense probably benign 0.00
R6245:Pcdhb9 UTSW 18 37403154 missense probably damaging 1.00
R6304:Pcdhb9 UTSW 18 37401367 missense probably damaging 0.99
R6542:Pcdhb9 UTSW 18 37401589 missense probably damaging 0.99
R6904:Pcdhb9 UTSW 18 37401917 missense probably benign 0.01
R7058:Pcdhb9 UTSW 18 37403281 missense probably benign 0.35
R7159:Pcdhb9 UTSW 18 37401492 missense possibly damaging 0.89
R7258:Pcdhb9 UTSW 18 37402114 missense probably damaging 1.00
R7800:Pcdhb9 UTSW 18 37401549 missense probably benign 0.01
R8027:Pcdhb9 UTSW 18 37403016 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATCCTTCCAGTTGCTCAAGGCCAC -3'
(R):5'- CCAGGAAAGTGTTCACCAGGCATAG -3'

Sequencing Primer
(F):5'- CACCACCAGGTTGTTGAGTG -3'
(R):5'- TGTTCACCAGGCATAGAGCAG -3'
Posted On2014-01-29