Incidental Mutation 'R1261:Slc10a1'
ID151608
Institutional Source Beutler Lab
Gene Symbol Slc10a1
Ensembl Gene ENSMUSG00000021135
Gene Namesolute carrier family 10 (sodium/bile acid cotransporter family), member 1
SynonymsNtcp, sodium bile acid cotransporting polypeptide
MMRRC Submission 039328-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1261 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location80953183-80968705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80967830 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 39 (M39L)
Ref Sequence ENSEMBL: ENSMUSP00000151215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095572] [ENSMUST00000218162] [ENSMUST00000218342] [ENSMUST00000220266]
Predicted Effect probably damaging
Transcript: ENSMUST00000095572
AA Change: M39L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093229
Gene: ENSMUSG00000021135
AA Change: M39L

DomainStartEndE-ValueType
Pfam:SBF 32 217 3.3e-47 PFAM
transmembrane domain 222 244 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218162
AA Change: M39L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000218342
AA Change: M39L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220266
AA Change: M39L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sodium/bile acid cotransporter family, which are integral membrane glycoproteins that participate in the enterohepatic circulation of bile acids. Two homologous transporters are involved in the reabsorption of bile acids; the ileal sodium/bile acid cotransporter with an apical cell localization that absorbs bile acids from the intestinal lumen, bile duct and kidney, and the liver-specific sodium/bile acid cotransporter, represented by this protein, that is found in the basolateral membranes of hepatocytes. Bile acids are the catabolic product of cholesterol metabolism, hence this protein is important for cholesterol homeostasis. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
Arhgef38 T C 3: 133,160,863 E171G possibly damaging Het
Arsi A G 18: 60,916,671 T209A probably damaging Het
BC005561 A G 5: 104,520,635 T1008A probably damaging Het
Bmp3 A T 5: 98,879,926 R468S probably damaging Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 G T 17: 46,525,782 L1106M probably damaging Het
Dnajc9 G A 14: 20,388,697 probably null Het
Enpp3 A T 10: 24,774,934 V768E probably damaging Het
Klk5 T C 7: 43,845,290 S66P probably damaging Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Myh7b A G 2: 155,621,083 K453R probably benign Het
Nipsnap3b G T 4: 53,015,166 G71V probably damaging Het
Oas1h A G 5: 120,871,867 E335G probably benign Het
Olfr1002 A C 2: 85,647,799 I174S probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Tmprss11d T C 5: 86,309,380 D140G possibly damaging Het
Other mutations in Slc10a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Slc10a1 APN 12 80960528 missense probably benign 0.00
IGL02065:Slc10a1 APN 12 80960474 missense possibly damaging 0.94
R0212:Slc10a1 UTSW 12 80967712 missense possibly damaging 0.62
R1170:Slc10a1 UTSW 12 80956028 missense probably damaging 1.00
R1832:Slc10a1 UTSW 12 80953672 missense probably benign 0.23
R2010:Slc10a1 UTSW 12 80960447 missense probably benign 0.00
R2094:Slc10a1 UTSW 12 80956048 missense possibly damaging 0.88
R2206:Slc10a1 UTSW 12 80967628 missense probably damaging 0.99
R3905:Slc10a1 UTSW 12 80967667 missense probably damaging 0.99
R4392:Slc10a1 UTSW 12 80967804 missense probably damaging 1.00
R4413:Slc10a1 UTSW 12 80958132 missense probably benign 0.01
R5173:Slc10a1 UTSW 12 80956028 missense probably damaging 1.00
R5344:Slc10a1 UTSW 12 80953766 missense possibly damaging 0.56
R7173:Slc10a1 UTSW 12 80955976 missense probably damaging 1.00
R7253:Slc10a1 UTSW 12 80958184 missense probably benign 0.16
R7413:Slc10a1 UTSW 12 80960622 missense probably benign 0.00
R7990:Slc10a1 UTSW 12 80953780 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATCATGACATCTCGGCAGCAC -3'
(R):5'- TGCCCACAGCTACATTTTGTCCAG -3'

Sequencing Primer
(F):5'- AGAGGTTAGACAGGTTCCCC -3'
(R):5'- CTCTGTCCTGAAAGAGGACTG -3'
Posted On2014-01-29