Incidental Mutation 'R1354:Gimap9'
ID156240
Institutional Source Beutler Lab
Gene Symbol Gimap9
Ensembl Gene ENSMUSG00000051124
Gene NameGTPase, IMAP family member 9
Synonyms
MMRRC Submission 039419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1354 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48676129-48679114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48678048 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 190 (M190L)
Ref Sequence ENSEMBL: ENSMUSP00000050330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054050] [ENSMUST00000147936]
Predicted Effect probably benign
Transcript: ENSMUST00000054050
AA Change: M190L

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000050330
Gene: ENSMUSG00000051124
AA Change: M190L

DomainStartEndE-ValueType
Pfam:AIG1 9 219 8.5e-83 PFAM
Pfam:MMR_HSR1 10 157 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147936
SMART Domains Protein: ENSMUSP00000122830
Gene: ENSMUSG00000051124

DomainStartEndE-ValueType
Pfam:MMR_HSR1 1 123 7.3e-11 PFAM
Pfam:AIG1 1 138 5.6e-61 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atoh1 A G 6: 64,729,357 E12G possibly damaging Het
Ccdc183 T C 2: 25,612,139 N241S probably benign Het
Cmya5 G A 13: 93,092,058 T2174I possibly damaging Het
Edem1 A G 6: 108,854,316 I579M possibly damaging Het
Glod4 A T 11: 76,237,828 probably null Het
Ighv8-6 A T 12: 115,166,080 S19T probably damaging Het
Lef1 C T 3: 131,194,668 P267S probably damaging Het
Megf11 A G 9: 64,653,177 E335G probably benign Het
Muc5ac A G 7: 141,807,377 N1475S probably damaging Het
Ndst2 C A 14: 20,724,975 R749L possibly damaging Het
Oas3 C A 5: 120,770,000 V292L possibly damaging Het
Phactr1 A T 13: 43,057,331 I210F possibly damaging Het
Plppr5 G A 3: 117,575,847 R51H possibly damaging Het
Ppp1r12b G A 1: 134,835,983 T771M probably benign Het
Rasgrf2 G A 13: 92,028,666 P331S probably damaging Het
Rtl6 C T 15: 84,556,527 V223M probably damaging Het
Tbc1d9 A C 8: 83,268,981 probably null Het
Tgm3 T C 2: 130,041,898 I492T probably benign Het
Trdv1 T A 14: 53,881,918 probably benign Het
Wdr45b A T 11: 121,335,430 I191N probably damaging Het
Other mutations in Gimap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Gimap9 APN 6 48677917 critical splice donor site probably null
IGL01568:Gimap9 APN 6 48677616 missense probably benign 0.07
R0442:Gimap9 UTSW 6 48678066 nonsense probably null
R2276:Gimap9 UTSW 6 48677878 missense probably benign 0.00
R6190:Gimap9 UTSW 6 48678351 missense probably damaging 1.00
R6930:Gimap9 UTSW 6 48677667 missense probably damaging 1.00
R7116:Gimap9 UTSW 6 48678055 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCGACTGGACCGTTACACTGAAGA -3'
(R):5'- AAAACAATTTGTGCCGCCTTTCCTT -3'

Sequencing Primer
(F):5'- AACGGTCGCTCTGATCAAG -3'
(R):5'- GCCTTTCCTTTTTCTAATTTAGCAG -3'
Posted On2014-02-11