Incidental Mutation 'R1354:Oas3'
ID156239
Institutional Source Beutler Lab
Gene Symbol Oas3
Ensembl Gene ENSMUSG00000032661
Gene Name2'-5' oligoadenylate synthetase 3
SynonymsOasl10, 2'-5' oligoadenylate synthetase-like 10
MMRRC Submission 039419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1354 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120753098-120777661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120770000 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 292 (V292L)
Ref Sequence ENSEMBL: ENSMUSP00000035588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044833
AA Change: V292L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661
AA Change: V292L

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166703
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme included in the 2', 5' oligoadenylate synthase family. This enzyme is induced by interferons and catalyzes the 2', 5' oligomers of adenosine in order to bind and activate RNase L. This enzyme family plays a significant role in the inhibition of cellular protein synthesis and viral infection resistance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atoh1 A G 6: 64,729,357 E12G possibly damaging Het
Ccdc183 T C 2: 25,612,139 N241S probably benign Het
Cmya5 G A 13: 93,092,058 T2174I possibly damaging Het
Edem1 A G 6: 108,854,316 I579M possibly damaging Het
Gimap9 A T 6: 48,678,048 M190L probably benign Het
Glod4 A T 11: 76,237,828 probably null Het
Ighv8-6 A T 12: 115,166,080 S19T probably damaging Het
Lef1 C T 3: 131,194,668 P267S probably damaging Het
Megf11 A G 9: 64,653,177 E335G probably benign Het
Muc5ac A G 7: 141,807,377 N1475S probably damaging Het
Ndst2 C A 14: 20,724,975 R749L possibly damaging Het
Phactr1 A T 13: 43,057,331 I210F possibly damaging Het
Plppr5 G A 3: 117,575,847 R51H possibly damaging Het
Ppp1r12b G A 1: 134,835,983 T771M probably benign Het
Rasgrf2 G A 13: 92,028,666 P331S probably damaging Het
Rtl6 C T 15: 84,556,527 V223M probably damaging Het
Tbc1d9 A C 8: 83,268,981 probably null Het
Tgm3 T C 2: 130,041,898 I492T probably benign Het
Trdv1 T A 14: 53,881,918 probably benign Het
Wdr45b A T 11: 121,335,430 I191N probably damaging Het
Other mutations in Oas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Oas3 APN 5 120777442 splice site probably benign
IGL01095:Oas3 APN 5 120772889 missense probably damaging 1.00
IGL01835:Oas3 APN 5 120766128 nonsense probably null
IGL02006:Oas3 APN 5 120769235 missense probably benign 0.00
IGL02811:Oas3 APN 5 120764322 missense unknown
IGL03194:Oas3 APN 5 120758953 missense probably damaging 1.00
R0066:Oas3 UTSW 5 120758875 missense probably damaging 1.00
R0195:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0196:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0197:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0445:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0523:Oas3 UTSW 5 120766144 missense unknown
R0592:Oas3 UTSW 5 120771149 missense probably damaging 1.00
R0946:Oas3 UTSW 5 120769063 missense unknown
R1642:Oas3 UTSW 5 120777574 missense possibly damaging 0.90
R1681:Oas3 UTSW 5 120769908 missense probably benign 0.22
R1844:Oas3 UTSW 5 120759980 missense probably damaging 0.99
R1981:Oas3 UTSW 5 120761835 splice site probably benign
R2443:Oas3 UTSW 5 120777488 missense probably benign 0.35
R2902:Oas3 UTSW 5 120758917 missense probably damaging 1.00
R3034:Oas3 UTSW 5 120771056 missense probably damaging 1.00
R4565:Oas3 UTSW 5 120771039 missense probably damaging 1.00
R4692:Oas3 UTSW 5 120769355 missense probably benign 0.03
R4723:Oas3 UTSW 5 120766256 missense unknown
R4812:Oas3 UTSW 5 120761147 unclassified probably benign
R5288:Oas3 UTSW 5 120756990 missense probably damaging 1.00
R5343:Oas3 UTSW 5 120756238 missense possibly damaging 0.70
R5494:Oas3 UTSW 5 120761644 missense unknown
R5688:Oas3 UTSW 5 120758802 missense probably benign 0.31
R5894:Oas3 UTSW 5 120756954 missense probably damaging 1.00
R5921:Oas3 UTSW 5 120769981 missense probably damaging 1.00
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6066:Oas3 UTSW 5 120772924 missense probably damaging 0.97
R6104:Oas3 UTSW 5 120761693 missense unknown
R6134:Oas3 UTSW 5 120769048 missense unknown
R6255:Oas3 UTSW 5 120771230 missense probably benign 0.04
R6257:Oas3 UTSW 5 120761135 unclassified probably benign
R6776:Oas3 UTSW 5 120758874 missense probably damaging 1.00
R8022:Oas3 UTSW 5 120756966 missense possibly damaging 0.91
R8137:Oas3 UTSW 5 120777500 missense probably benign 0.07
RF006:Oas3 UTSW 5 120774100 missense probably damaging 1.00
X0024:Oas3 UTSW 5 120761728 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCTTATCAGCCAGAGCAGAAAGTG -3'
(R):5'- GGCTCCAGCAAAGTGGGTGATAC -3'

Sequencing Primer
(F):5'- TTCTAGGTGGACAGACATATCCAG -3'
(R):5'- AGTGGGTGATACCATCATTATGC -3'
Posted On2014-02-11