Incidental Mutation 'R1354:Plppr5'
ID156237
Institutional Source Beutler Lab
Gene Symbol Plppr5
Ensembl Gene ENSMUSG00000033342
Gene Namephospholipid phosphatase related 5
Synonyms4833424O15Rik, Lppr5
MMRRC Submission 039419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1354 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location117574836-117689507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117575847 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 51 (R51H)
Ref Sequence ENSEMBL: ENSMUSP00000102081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039564] [ENSMUST00000106473]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039564
AA Change: R51H

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045121
Gene: ENSMUSG00000033342
AA Change: R51H

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
acidPPc 123 267 8.27e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106473
AA Change: R51H

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102081
Gene: ENSMUSG00000033342
AA Change: R51H

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
acidPPc 123 267 8.27e-20 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type 2 member of the phosphatidic acid phosphatase (PAP) family. All type 2 members of this protein family contain 6 transmembrane regions, and a consensus N-glycosylation site. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atoh1 A G 6: 64,729,357 E12G possibly damaging Het
Ccdc183 T C 2: 25,612,139 N241S probably benign Het
Cmya5 G A 13: 93,092,058 T2174I possibly damaging Het
Edem1 A G 6: 108,854,316 I579M possibly damaging Het
Gimap9 A T 6: 48,678,048 M190L probably benign Het
Glod4 A T 11: 76,237,828 probably null Het
Ighv8-6 A T 12: 115,166,080 S19T probably damaging Het
Lef1 C T 3: 131,194,668 P267S probably damaging Het
Megf11 A G 9: 64,653,177 E335G probably benign Het
Muc5ac A G 7: 141,807,377 N1475S probably damaging Het
Ndst2 C A 14: 20,724,975 R749L possibly damaging Het
Oas3 C A 5: 120,770,000 V292L possibly damaging Het
Phactr1 A T 13: 43,057,331 I210F possibly damaging Het
Ppp1r12b G A 1: 134,835,983 T771M probably benign Het
Rasgrf2 G A 13: 92,028,666 P331S probably damaging Het
Rtl6 C T 15: 84,556,527 V223M probably damaging Het
Tbc1d9 A C 8: 83,268,981 probably null Het
Tgm3 T C 2: 130,041,898 I492T probably benign Het
Trdv1 T A 14: 53,881,918 probably benign Het
Wdr45b A T 11: 121,335,430 I191N probably damaging Het
Other mutations in Plppr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Plppr5 APN 3 117671943 missense possibly damaging 0.46
IGL01081:Plppr5 APN 3 117686649 utr 3 prime probably benign
IGL01315:Plppr5 APN 3 117662526 missense probably damaging 1.00
IGL02802:Plppr5 UTSW 3 117662579 missense probably damaging 1.00
R0044:Plppr5 UTSW 3 117671889 splice site probably null
R0044:Plppr5 UTSW 3 117671889 splice site probably null
R0332:Plppr5 UTSW 3 117671932 missense probably benign 0.05
R0757:Plppr5 UTSW 3 117575891 missense probably benign 0.16
R1101:Plppr5 UTSW 3 117662523 missense probably damaging 0.99
R1498:Plppr5 UTSW 3 117662612 missense probably damaging 0.97
R1967:Plppr5 UTSW 3 117625906 critical splice donor site probably null
R2090:Plppr5 UTSW 3 117575871 missense possibly damaging 0.63
R4661:Plppr5 UTSW 3 117620969 missense probably damaging 1.00
R5143:Plppr5 UTSW 3 117625903 missense probably benign
R5441:Plppr5 UTSW 3 117662471 missense possibly damaging 0.94
R5722:Plppr5 UTSW 3 117621065 missense probably benign 0.00
R6560:Plppr5 UTSW 3 117671990 missense probably benign 0.09
R7221:Plppr5 UTSW 3 117620969 missense probably damaging 1.00
Z1177:Plppr5 UTSW 3 117625779 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGCTCCAGCTATACAACATCCG -3'
(R):5'- GGACTGCCACCAAGTTAGAGGAAC -3'

Sequencing Primer
(F):5'- Tcctccgcctctgcctc -3'
(R):5'- CCACCAAGTTAGAGGAACTTAGATG -3'
Posted On2014-02-11