Incidental Mutation 'R1305:Snrnp40'
ID157770
Institutional Source Beutler Lab
Gene Symbol Snrnp40
Ensembl Gene ENSMUSG00000074088
Gene Namesmall nuclear ribonucleoprotein 40 (U5)
Synonyms0610009C03Rik, Wdr57
MMRRC Submission 039371-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1305 (G1)
Quality Score130
Status Not validated
Chromosome4
Chromosomal Location130360132-130390026 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to G at 130378043 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105994]
Predicted Effect probably null
Transcript: ENSMUST00000105994
SMART Domains Protein: ENSMUSP00000101616
Gene: ENSMUSG00000074088

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
WD40 56 95 1.64e-9 SMART
WD40 99 138 1.83e-7 SMART
WD40 141 181 8.68e-9 SMART
WD40 184 222 3.81e-5 SMART
WD40 225 264 3.24e-8 SMART
WD40 271 314 5.1e-6 SMART
WD40 317 356 2.84e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180577
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the U5 small nuclear ribonucleoprotein (snRNP) particle. The U5 snRNP is part of the spliceosome, a multiprotein complex that catalyzes the removal of introns from pre-messenger RNAs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2 G A 5: 121,749,184 V306I probably damaging Het
Enc1 T C 13: 97,246,700 Y573H possibly damaging Het
Gm13757 A T 2: 88,446,302 L212* probably null Het
Gm9869 T C 9: 60,821,886 probably benign Het
Ifna2 T C 4: 88,683,377 T135A probably benign Het
Ifngr1 C T 10: 19,606,253 T197M possibly damaging Het
Kcnj4 A T 15: 79,484,819 V320E probably damaging Het
Map2 T A 1: 66,425,395 I1648N probably damaging Het
Map4k1 A T 7: 28,995,465 M435L probably benign Het
Mark3 T A 12: 111,615,446 probably null Het
Mex3c T A 18: 73,590,235 F466L probably benign Het
Msl3l2 T C 10: 56,115,535 C119R probably damaging Het
Msln T C 17: 25,753,027 E72G probably benign Het
Nid2 T C 14: 19,768,862 S475P probably benign Het
Nme8 T A 13: 19,696,907 N18I possibly damaging Het
Nwd2 G T 5: 63,745,197 W86L probably damaging Het
Olfr1353 T C 10: 78,970,099 I150T probably benign Het
Pard3 T A 8: 127,306,410 S162T possibly damaging Het
Ppm1a C A 12: 72,783,720 D6E probably damaging Het
Rcor3 C T 1: 192,116,346 V312I possibly damaging Het
Rgs20 T A 1: 5,021,039 probably null Het
Slc11a2 C A 15: 100,410,082 probably null Het
Vmn1r124 C A 7: 21,260,263 V119F probably benign Het
Zfp827 A G 8: 79,060,894 T230A possibly damaging Het
Zfp945 T C 17: 22,852,386 K180E probably damaging Het
Other mutations in Snrnp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Snrnp40 APN 4 130360221 missense probably damaging 0.99
IGL02306:Snrnp40 APN 4 130365100 missense probably benign 0.21
skywarp UTSW 4 130378043 splice site probably null
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0077:Snrnp40 UTSW 4 130378043 splice site probably null
R0134:Snrnp40 UTSW 4 130378043 splice site probably null
R0211:Snrnp40 UTSW 4 130378043 splice site probably null
R0349:Snrnp40 UTSW 4 130378043 splice site probably null
R0371:Snrnp40 UTSW 4 130378043 splice site probably null
R0372:Snrnp40 UTSW 4 130378043 splice site probably null
R0376:Snrnp40 UTSW 4 130378043 splice site probably null
R0377:Snrnp40 UTSW 4 130378043 splice site probably null
R0400:Snrnp40 UTSW 4 130362650 missense probably damaging 1.00
R0442:Snrnp40 UTSW 4 130378043 splice site probably null
R0443:Snrnp40 UTSW 4 130378043 splice site probably null
R0486:Snrnp40 UTSW 4 130378043 splice site probably null
R0488:Snrnp40 UTSW 4 130378043 splice site probably null
R0568:Snrnp40 UTSW 4 130378043 splice site probably null
R0624:Snrnp40 UTSW 4 130362658 missense probably damaging 0.98
R0632:Snrnp40 UTSW 4 130378043 splice site probably null
R0650:Snrnp40 UTSW 4 130378043 splice site probably null
R0733:Snrnp40 UTSW 4 130378043 splice site probably null
R1161:Snrnp40 UTSW 4 130378043 splice site probably null
R1182:Snrnp40 UTSW 4 130378043 splice site probably null
R1234:Snrnp40 UTSW 4 130378043 splice site probably null
R1236:Snrnp40 UTSW 4 130378043 splice site probably null
R1308:Snrnp40 UTSW 4 130378043 splice site probably null
R1333:Snrnp40 UTSW 4 130378043 splice site probably null
R1413:Snrnp40 UTSW 4 130378043 splice site probably null
R1569:Snrnp40 UTSW 4 130378043 splice site probably null
R1616:Snrnp40 UTSW 4 130378043 splice site probably null
R1656:Snrnp40 UTSW 4 130378043 splice site probably null
R1675:Snrnp40 UTSW 4 130378043 splice site probably null
R1759:Snrnp40 UTSW 4 130378043 splice site probably null
R1856:Snrnp40 UTSW 4 130378043 splice site probably null
R1901:Snrnp40 UTSW 4 130385975 missense probably damaging 0.98
R1912:Snrnp40 UTSW 4 130378043 splice site probably null
R1930:Snrnp40 UTSW 4 130378043 splice site probably null
R1931:Snrnp40 UTSW 4 130378043 splice site probably null
R2435:Snrnp40 UTSW 4 130384551 missense probably damaging 1.00
R3722:Snrnp40 UTSW 4 130368275 missense possibly damaging 0.76
R4782:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R4799:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R5075:Snrnp40 UTSW 4 130388582 missense probably benign 0.07
R5104:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R5369:Snrnp40 UTSW 4 130362646 missense probably damaging 0.97
R5699:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R7529:Snrnp40 UTSW 4 130384482 missense possibly damaging 0.94
R8264:Snrnp40 UTSW 4 130378074 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAAGTGGGTGCAGGGAATCATA -3'
(R):5'- TAATCTGATCGCTCGTGTCATTG -3'

Sequencing Primer
(F):5'- ATACGTGGGTGCTCTGGAAG -3'
(R):5'- TTGAAGGTCACAGCCAACAC -3'
Posted On2014-02-18