Incidental Mutation 'R1307:Havcr1'
ID157838
Institutional Source Beutler Lab
Gene Symbol Havcr1
Ensembl Gene ENSMUSG00000040405
Gene Namehepatitis A virus cellular receptor 1
SynonymsKIM-1, Tim1, TIM-1
MMRRC Submission 039373-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1307 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location46735080-46779578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46756270 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 177 (T177I)
Ref Sequence ENSEMBL: ENSMUSP00000043827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047568] [ENSMUST00000081819] [ENSMUST00000109223] [ENSMUST00000109224]
Predicted Effect probably damaging
Transcript: ENSMUST00000047568
AA Change: T177I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043827
Gene: ENSMUSG00000040405
AA Change: T177I

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081819
AA Change: T177I

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080503
Gene: ENSMUSG00000040405
AA Change: T177I

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109223
AA Change: T177I

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104846
Gene: ENSMUSG00000040405
AA Change: T177I

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109224
SMART Domains Protein: ENSMUSP00000104847
Gene: ENSMUSG00000040405

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to S. mansoni egg challenge. Mice homozygous for an allele lacking the mucin domain display impaired regulatory B cell function and systemic autoimmunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc1 A T 10: 60,012,499 I83L probably benign Het
Bcl2a1b T C 9: 89,199,490 V44A probably damaging Het
Bdp1 T C 13: 100,049,763 D1727G possibly damaging Het
Cabp1 A G 5: 115,172,906 F294L probably damaging Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Gk2 A T 5: 97,455,409 D523E probably benign Het
Kdm4a T C 4: 118,175,642 T76A probably benign Het
Lama4 A T 10: 39,070,032 I804F probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pcdh10 A G 3: 45,381,879 N876S probably benign Het
Polr3f T C 2: 144,533,193 V95A probably damaging Het
Ptk2 A G 15: 73,292,046 V389A probably benign Het
Rhof T C 5: 123,120,315 E151G probably damaging Het
Slc25a28 T C 19: 43,667,031 N135S probably benign Het
Sphk1 G A 11: 116,536,102 V295I probably benign Het
Sv2b G T 7: 75,206,434 T36K probably damaging Het
Sybu T C 15: 44,675,390 E291G probably damaging Het
Tnc T C 4: 64,008,859 E810G probably damaging Het
Uba52 T C 8: 70,508,516 H68R probably damaging Het
Unc79 A G 12: 103,070,076 N552S probably damaging Het
Ush2a T C 1: 188,357,967 C416R probably damaging Het
Ush2a T C 1: 188,451,840 V1447A probably damaging Het
Zfp985 C T 4: 147,583,247 L191F probably benign Het
Other mutations in Havcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Havcr1 APN 11 46775493 missense probably damaging 1.00
IGL02207:Havcr1 APN 11 46778576 missense probably benign 0.28
R0355:Havcr1 UTSW 11 46756224 missense possibly damaging 0.91
R0371:Havcr1 UTSW 11 46752589 missense possibly damaging 0.95
R0488:Havcr1 UTSW 11 46752571 missense probably damaging 1.00
R0883:Havcr1 UTSW 11 46752432 missense probably damaging 1.00
R1308:Havcr1 UTSW 11 46756270 missense probably damaging 0.99
R1554:Havcr1 UTSW 11 46752507 missense probably benign
R1908:Havcr1 UTSW 11 46773684 nonsense probably null
R2165:Havcr1 UTSW 11 46778552 missense probably benign 0.14
R3085:Havcr1 UTSW 11 46756225 missense probably damaging 0.99
R3757:Havcr1 UTSW 11 46752580 missense probably damaging 1.00
R4719:Havcr1 UTSW 11 46752441 missense probably benign 0.02
R5191:Havcr1 UTSW 11 46756197 missense probably benign 0.40
R5440:Havcr1 UTSW 11 46752370 missense probably damaging 1.00
R5710:Havcr1 UTSW 11 46752526 missense probably damaging 1.00
R5988:Havcr1 UTSW 11 46756137 missense probably damaging 1.00
R7570:Havcr1 UTSW 11 46770542 critical splice donor site probably null
R7962:Havcr1 UTSW 11 46752575 nonsense probably null
Z1177:Havcr1 UTSW 11 46775498 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGTCGAAGCTCTTGTCACTTCTTGC -3'
(R):5'- AGTGGCCCTGGTTCTCAGTCATTC -3'

Sequencing Primer
(F):5'- TGCCTGACTCATCCTTGC -3'
(R):5'- TTCATCAGAGAGTCATGCCCAG -3'
Posted On2014-02-18