Incidental Mutation 'R1308:Otoa'
ID 157853
Institutional Source Beutler Lab
Gene Symbol Otoa
Ensembl Gene ENSMUSG00000034990
Gene Name otoancorin
Synonyms
MMRRC Submission 039374-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1308 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 120682647-120762316 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 120724666 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 448 (C448*)
Ref Sequence ENSEMBL: ENSMUSP00000044177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047025] [ENSMUST00000163275]
AlphaFold Q8K561
Predicted Effect probably null
Transcript: ENSMUST00000047025
AA Change: C448*
SMART Domains Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990
AA Change: C448*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1072 1089 N/A INTRINSIC
low complexity region 1124 1133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163275
Predicted Effect probably benign
Transcript: ENSMUST00000165409
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is specifically expressed in the inner ear, and is located at the interface between the apical surface of the inner ear sensory epithelia and their overlying acellular gels. It is prposed that this protein is involved in the attachment of the inner ear acellular gels to the apical surface of the underlying nonsensory cells. Mutations in this gene are associated with autosomal recessive deafness type 22 (DFNB22). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss, detachment of the tectorial membrane from the spiral limbus, abnormal tectorial membrane morphology, absence of Hensen's stripe and increased cochlear nerve coumpond action potential threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt2 C T 8: 18,742,134 (GRCm39) W474* probably null Het
Cln6 A G 9: 62,758,143 (GRCm39) T301A probably damaging Het
G6pc2 A T 2: 69,050,570 (GRCm39) D65V probably damaging Het
Havcr1 C T 11: 46,647,097 (GRCm39) T177I probably damaging Het
Jph1 A G 1: 17,161,918 (GRCm39) I248T probably damaging Het
Lamc2 A G 1: 153,026,564 (GRCm39) L230P probably damaging Het
Lmnb1 A G 18: 56,861,547 (GRCm39) K146R probably benign Het
Map3k6 T C 4: 132,973,126 (GRCm39) S395P probably damaging Het
Myo6 G A 9: 80,152,996 (GRCm39) V210I probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Pate6 T C 9: 35,700,385 (GRCm39) T67A probably benign Het
Prkcg G C 7: 3,377,622 (GRCm39) K525N probably damaging Het
Pros1 G A 16: 62,734,228 (GRCm39) D345N probably damaging Het
Prss47 T C 13: 65,199,630 (GRCm39) H83R probably benign Het
R3hdml G T 2: 163,344,319 (GRCm39) C236F probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Syt12 A T 19: 4,510,763 (GRCm39) V37E probably damaging Het
Tekt2 A T 4: 126,218,711 (GRCm39) L14H probably damaging Het
Tnpo2 T C 8: 85,781,982 (GRCm39) F857S probably damaging Het
Wdr27 T C 17: 15,148,646 (GRCm39) T116A probably damaging Het
Other mutations in Otoa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Otoa APN 7 120,754,496 (GRCm39) critical splice donor site probably null
IGL01791:Otoa APN 7 120,755,072 (GRCm39) missense probably benign 0.25
IGL01924:Otoa APN 7 120,705,191 (GRCm39) missense probably damaging 0.99
IGL01953:Otoa APN 7 120,759,548 (GRCm39) splice site probably null
IGL02121:Otoa APN 7 120,721,247 (GRCm39) missense probably benign 0.06
IGL02303:Otoa APN 7 120,732,147 (GRCm39) critical splice donor site probably null
IGL02390:Otoa APN 7 120,730,590 (GRCm39) missense possibly damaging 0.84
IGL02591:Otoa APN 7 120,755,053 (GRCm39) missense probably damaging 1.00
IGL02811:Otoa APN 7 120,717,878 (GRCm39) missense possibly damaging 0.60
IGL02878:Otoa APN 7 120,743,076 (GRCm39) missense probably damaging 1.00
IGL03328:Otoa APN 7 120,710,217 (GRCm39) missense probably damaging 0.98
R0056:Otoa UTSW 7 120,730,570 (GRCm39) missense probably benign 0.00
R0279:Otoa UTSW 7 120,710,302 (GRCm39) splice site probably benign
R0390:Otoa UTSW 7 120,730,564 (GRCm39) missense probably benign 0.07
R0411:Otoa UTSW 7 120,755,750 (GRCm39) critical splice donor site probably null
R0628:Otoa UTSW 7 120,744,873 (GRCm39) splice site probably benign
R1113:Otoa UTSW 7 120,724,666 (GRCm39) nonsense probably null
R1240:Otoa UTSW 7 120,755,713 (GRCm39) missense probably benign
R1692:Otoa UTSW 7 120,690,774 (GRCm39) missense probably damaging 0.99
R1728:Otoa UTSW 7 120,724,662 (GRCm39) missense probably benign 0.36
R1729:Otoa UTSW 7 120,724,662 (GRCm39) missense probably benign 0.36
R1744:Otoa UTSW 7 120,726,999 (GRCm39) splice site probably benign
R1759:Otoa UTSW 7 120,733,326 (GRCm39) missense probably damaging 1.00
R1784:Otoa UTSW 7 120,724,662 (GRCm39) missense probably benign 0.36
R1817:Otoa UTSW 7 120,759,753 (GRCm39) utr 3 prime probably benign
R1961:Otoa UTSW 7 120,717,792 (GRCm39) missense probably benign 0.05
R2061:Otoa UTSW 7 120,730,551 (GRCm39) missense probably damaging 1.00
R2509:Otoa UTSW 7 120,759,695 (GRCm39) missense probably benign
R2510:Otoa UTSW 7 120,759,695 (GRCm39) missense probably benign
R3411:Otoa UTSW 7 120,721,266 (GRCm39) missense probably damaging 1.00
R3438:Otoa UTSW 7 120,759,566 (GRCm39) missense possibly damaging 0.80
R3905:Otoa UTSW 7 120,724,788 (GRCm39) missense probably damaging 1.00
R3907:Otoa UTSW 7 120,724,788 (GRCm39) missense probably damaging 1.00
R4613:Otoa UTSW 7 120,744,791 (GRCm39) missense probably damaging 1.00
R4751:Otoa UTSW 7 120,732,147 (GRCm39) critical splice donor site probably benign
R4896:Otoa UTSW 7 120,701,902 (GRCm39) missense probably damaging 1.00
R4932:Otoa UTSW 7 120,754,358 (GRCm39) missense probably damaging 0.98
R5224:Otoa UTSW 7 120,739,016 (GRCm39) missense probably damaging 0.98
R5235:Otoa UTSW 7 120,755,693 (GRCm39) missense probably damaging 1.00
R5595:Otoa UTSW 7 120,721,200 (GRCm39) missense probably damaging 1.00
R5891:Otoa UTSW 7 120,731,583 (GRCm39) splice site probably null
R5894:Otoa UTSW 7 120,721,092 (GRCm39) missense probably damaging 1.00
R5905:Otoa UTSW 7 120,693,824 (GRCm39) missense probably damaging 1.00
R5976:Otoa UTSW 7 120,726,936 (GRCm39) missense probably benign 0.00
R6464:Otoa UTSW 7 120,701,828 (GRCm39) missense probably damaging 1.00
R6761:Otoa UTSW 7 120,721,173 (GRCm39) missense probably damaging 1.00
R6770:Otoa UTSW 7 120,744,837 (GRCm39) missense probably benign 0.25
R6821:Otoa UTSW 7 120,692,070 (GRCm39) critical splice donor site probably null
R6924:Otoa UTSW 7 120,730,724 (GRCm39) splice site probably null
R7016:Otoa UTSW 7 120,746,989 (GRCm39) missense probably damaging 0.99
R7215:Otoa UTSW 7 120,717,795 (GRCm39) missense unknown
R7313:Otoa UTSW 7 120,701,765 (GRCm39) missense probably benign 0.42
R7340:Otoa UTSW 7 120,729,288 (GRCm39) missense probably benign 0.38
R7443:Otoa UTSW 7 120,731,633 (GRCm39) missense probably benign 0.00
R7559:Otoa UTSW 7 120,743,149 (GRCm39) missense probably damaging 0.99
R7640:Otoa UTSW 7 120,744,849 (GRCm39) missense probably damaging 1.00
R7654:Otoa UTSW 7 120,746,923 (GRCm39) missense probably damaging 1.00
R7659:Otoa UTSW 7 120,733,267 (GRCm39) missense probably benign 0.01
R8421:Otoa UTSW 7 120,698,491 (GRCm39) critical splice donor site probably null
R8799:Otoa UTSW 7 120,691,894 (GRCm39) missense possibly damaging 0.56
R8954:Otoa UTSW 7 120,744,741 (GRCm39) nonsense probably null
R9099:Otoa UTSW 7 120,739,055 (GRCm39) missense probably benign
R9126:Otoa UTSW 7 120,693,845 (GRCm39) missense probably damaging 1.00
R9369:Otoa UTSW 7 120,744,840 (GRCm39) missense probably benign 0.23
U24488:Otoa UTSW 7 120,717,763 (GRCm39) critical splice acceptor site probably null
X0023:Otoa UTSW 7 120,717,794 (GRCm39) missense probably benign 0.00
Z1177:Otoa UTSW 7 120,717,878 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGAGGGAGATTGTTGCAGTCC -3'
(R):5'- TCTGGAAGAGACAAGGCAGCACTC -3'

Sequencing Primer
(F):5'- TCCTGGAAAAGAGGCTCGTC -3'
(R):5'- AGACTCTGATAACTACATCCTCTGTG -3'
Posted On 2014-02-18