Incidental Mutation 'R1308:Pros1'
ID157863
Institutional Source Beutler Lab
Gene Symbol Pros1
Ensembl Gene ENSMUSG00000022912
Gene Nameprotein S (alpha)
Synonymsprotein S
MMRRC Submission 039374-MU
Accession Numbers

Genbank: NM_011173; MGI: 1095733  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1308 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location62854307-62929346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62913865 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 345 (D345N)
Ref Sequence ENSEMBL: ENSMUSP00000023629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023629]
Predicted Effect probably damaging
Transcript: ENSMUST00000023629
AA Change: D345N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: D345N

DomainStartEndE-ValueType
GLA 23 86 3.63e-31 SMART
EGF 120 155 4.39e-2 SMART
EGF_CA 157 200 6.91e-9 SMART
EGF_CA 201 242 5.23e-9 SMART
EGF_CA 243 283 1.1e-7 SMART
LamG 321 458 8.55e-22 SMART
LamG 506 646 1.57e-1 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt2 C T 8: 18,692,118 W474* probably null Het
Cln6 A G 9: 62,850,861 T301A probably damaging Het
D730048I06Rik T C 9: 35,789,089 T67A probably benign Het
G6pc2 A T 2: 69,220,226 D65V probably damaging Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Jph1 A G 1: 17,091,694 I248T probably damaging Het
Lamc2 A G 1: 153,150,818 L230P probably damaging Het
Lmnb1 A G 18: 56,728,475 K146R probably benign Het
Map3k6 T C 4: 133,245,815 S395P probably damaging Het
Myo6 G A 9: 80,245,714 V210I probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Otoa C A 7: 121,125,443 C448* probably null Het
Prkcg G C 7: 3,329,106 K525N probably damaging Het
Prss47 T C 13: 65,051,816 H83R probably benign Het
R3hdml G T 2: 163,502,399 C236F probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt12 A T 19: 4,460,735 V37E probably damaging Het
Tekt2 A T 4: 126,324,918 L14H probably damaging Het
Tnpo2 T C 8: 85,055,353 F857S probably damaging Het
Wdr27 T C 17: 14,928,384 T116A probably damaging Het
Other mutations in Pros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Pros1 APN 16 62910045 missense probably damaging 0.99
IGL01300:Pros1 APN 16 62913811 missense possibly damaging 0.85
IGL02709:Pros1 APN 16 62898945 missense probably damaging 0.99
IGL03080:Pros1 APN 16 62918143 missense probably damaging 0.98
IGL03095:Pros1 APN 16 62907769 nonsense probably null
F6893:Pros1 UTSW 16 62924639 missense probably damaging 0.98
R0124:Pros1 UTSW 16 62913946 missense possibly damaging 0.95
R0517:Pros1 UTSW 16 62903518 missense probably benign 0.03
R1113:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1355:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1370:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1517:Pros1 UTSW 16 62885512 missense probably damaging 0.98
R1866:Pros1 UTSW 16 62928135 missense possibly damaging 0.86
R1876:Pros1 UTSW 16 62903518 missense probably damaging 0.96
R2255:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R2364:Pros1 UTSW 16 62913848 missense probably damaging 0.99
R2369:Pros1 UTSW 16 62928069 missense probably damaging 1.00
R2979:Pros1 UTSW 16 62913866 missense probably damaging 0.99
R3724:Pros1 UTSW 16 62900329 missense possibly damaging 0.86
R4056:Pros1 UTSW 16 62900645 nonsense probably null
R4556:Pros1 UTSW 16 62900673 missense possibly damaging 0.95
R4688:Pros1 UTSW 16 62889007 critical splice donor site probably null
R4850:Pros1 UTSW 16 62885524 missense probably damaging 0.98
R4923:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R5008:Pros1 UTSW 16 62928185 missense possibly damaging 0.53
R5370:Pros1 UTSW 16 62913976 missense probably benign 0.01
R5580:Pros1 UTSW 16 62926326 critical splice acceptor site probably null
R5930:Pros1 UTSW 16 62928061 missense probably damaging 0.96
R5974:Pros1 UTSW 16 62900667 missense probably damaging 0.98
R6233:Pros1 UTSW 16 62898921 missense possibly damaging 0.47
R6949:Pros1 UTSW 16 62924575 missense probably benign 0.01
R7055:Pros1 UTSW 16 62928102 missense possibly damaging 0.85
R7347:Pros1 UTSW 16 62919523 missense probably damaging 0.97
R7375:Pros1 UTSW 16 62924550 missense probably damaging 0.96
R7419:Pros1 UTSW 16 62928070 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCGTATAGTACCGTTTGCCAGTCC -3'
(R):5'- TGATTCCTGACCTAAAGGGGAGACC -3'

Sequencing Primer
(F):5'- TGCCAGTCCAAGGTGTGAG -3'
(R):5'- GGGGAGACCCCATAATTCAC -3'
Posted On2014-02-18