Incidental Mutation 'R7654:Otoa'
ID591073
Institutional Source Beutler Lab
Gene Symbol Otoa
Ensembl Gene ENSMUSG00000034990
Gene Nameotoancorin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7654 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location121081650-121163097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 121147700 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 896 (L896R)
Ref Sequence ENSEMBL: ENSMUSP00000044177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047025] [ENSMUST00000163275]
Predicted Effect probably damaging
Transcript: ENSMUST00000047025
AA Change: L896R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990
AA Change: L896R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1072 1089 N/A INTRINSIC
low complexity region 1124 1133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163275
Predicted Effect probably benign
Transcript: ENSMUST00000165409
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is specifically expressed in the inner ear, and is located at the interface between the apical surface of the inner ear sensory epithelia and their overlying acellular gels. It is prposed that this protein is involved in the attachment of the inner ear acellular gels to the apical surface of the underlying nonsensory cells. Mutations in this gene are associated with autosomal recessive deafness type 22 (DFNB22). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss, detachment of the tectorial membrane from the spiral limbus, abnormal tectorial membrane morphology, absence of Hensen's stripe and increased cochlear nerve coumpond action potential threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,826,593 V1140M possibly damaging Het
Adamtsl3 A C 7: 82,574,494 E1161A probably benign Het
Adcy5 T C 16: 35,270,947 S587P probably damaging Het
Aebp2 T A 6: 140,653,748 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankhd1 T C 18: 36,594,101 V423A probably damaging Het
Arid1b T A 17: 5,291,085 M888K possibly damaging Het
Asl C A 5: 130,018,390 R122S probably damaging Het
B3gntl1 T A 11: 121,651,613 D109V probably damaging Het
Cat G A 2: 103,460,364 P402S probably damaging Het
Ccdc141 A T 2: 77,042,478 Y787N probably benign Het
Ccdc78 T C 17: 25,790,111 Y405H probably damaging Het
Ces1f T G 8: 93,271,934 K145Q probably benign Het
Cfap65 A T 1: 74,933,144 C19S probably benign Het
CN725425 T A 15: 91,239,435 I118N probably benign Het
Ctc1 C T 11: 69,026,215 P312S probably damaging Het
Ctsa C T 2: 164,838,933 T442I probably benign Het
Cyp2b9 A G 7: 26,186,942 T131A possibly damaging Het
D630045J12Rik A G 6: 38,177,701 M1181T probably damaging Het
Dagla C G 19: 10,248,206 G865R probably benign Het
Dst A C 1: 34,228,977 K3153Q probably damaging Het
Dst A T 1: 34,228,978 K3153M probably damaging Het
Dync2h1 A T 9: 7,122,664 H2097Q probably damaging Het
Etnppl A G 3: 130,629,511 I286M probably benign Het
Flvcr1 A T 1: 191,011,605 M418K possibly damaging Het
Fuca1 T C 4: 135,929,921 S215P probably damaging Het
Gabrg1 T C 5: 70,778,161 K222E probably benign Het
Gdpd5 G A 7: 99,424,189 R26H probably damaging Het
Gnptab T A 10: 88,445,819 S1229R possibly damaging Het
Gpt A G 15: 76,698,330 E256G probably benign Het
Hif3a C T 7: 17,049,096 V261I probably damaging Het
Hmcn2 A G 2: 31,346,569 T375A probably benign Het
Hspa4 C A 11: 53,300,124 V15F probably damaging Het
Il18 A G 9: 50,579,401 N112S possibly damaging Het
Inpp4a A G 1: 37,374,098 probably null Het
Knop1 A G 7: 118,845,809 S525P unknown Het
Leo1 A T 9: 75,455,679 Y461F possibly damaging Het
Med1 C T 11: 98,169,363 V247I possibly damaging Het
Mpnd T G 17: 56,010,489 H159Q probably benign Het
Msl1 A G 11: 98,796,111 E94G possibly damaging Het
Mthfd2l A T 5: 90,946,806 I45F probably damaging Het
Neurl1b T A 17: 26,438,697 L203Q probably benign Het
Olfr1024 G T 2: 85,904,319 T245N possibly damaging Het
Pcdhac2 T A 18: 37,145,023 V352E probably damaging Het
Pcsk5 T A 19: 17,456,804 K1400I possibly damaging Het
Pcx T A 19: 4,515,669 probably null Het
Pds5a A G 5: 65,618,981 V90A probably damaging Het
Pgam2 T C 11: 5,803,351 K113R probably null Het
Phkb G T 8: 85,940,887 R266L possibly damaging Het
Phtf2 A G 5: 20,782,461 S346P probably damaging Het
Pkd1l3 G A 8: 109,638,417 A1144T probably damaging Het
Plbd1 T C 6: 136,651,866 Y68C possibly damaging Het
Polk T C 13: 96,496,813 T241A probably benign Het
Ppfibp2 T A 7: 107,738,611 D635E probably damaging Het
Ppip5k1 G A 2: 121,348,559 R229W probably damaging Het
Ptpn20 A G 14: 33,638,324 D386G probably benign Het
Rab22a T C 2: 173,688,175 Y49H probably benign Het
Rab3gap1 A G 1: 127,909,915 D238G probably damaging Het
Rbp3 T C 14: 33,955,840 S582P probably benign Het
Rcbtb2 T C 14: 73,174,501 V410A probably benign Het
Sh3rf2 A G 18: 42,104,108 E232G probably damaging Het
Shroom1 T A 11: 53,466,908 V762E probably benign Het
Speer4f2 A T 5: 17,374,415 M71L Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Tgfb1 A T 7: 25,687,695 probably benign Het
Tnik C T 3: 28,604,185 R540C probably damaging Het
Tti1 A T 2: 158,008,554 I255N probably benign Het
Ttn T C 2: 76,897,146 S5739G unknown Het
Umad1 G A 6: 8,426,995 V57M probably damaging Het
Usp30 T A 5: 114,102,445 I49N probably damaging Het
Usp7 G A 16: 8,702,043 T398I probably benign Het
Vmn2r65 A G 7: 84,941,053 Y552H probably damaging Het
Zfp616 A G 11: 74,083,187 N185S possibly damaging Het
Zfp804b T A 5: 6,769,458 T1202S probably damaging Het
Zfyve28 A T 5: 34,243,195 V53D probably damaging Het
Other mutations in Otoa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Otoa APN 7 121155273 critical splice donor site probably null
IGL01791:Otoa APN 7 121155849 missense probably benign 0.25
IGL01924:Otoa APN 7 121105968 missense probably damaging 0.99
IGL01953:Otoa APN 7 121160325 splice site probably null
IGL02121:Otoa APN 7 121122024 missense probably benign 0.06
IGL02303:Otoa APN 7 121132924 critical splice donor site probably null
IGL02390:Otoa APN 7 121131367 missense possibly damaging 0.84
IGL02591:Otoa APN 7 121155830 missense probably damaging 1.00
IGL02811:Otoa APN 7 121118655 missense possibly damaging 0.60
IGL02878:Otoa APN 7 121143853 missense probably damaging 1.00
IGL03328:Otoa APN 7 121110994 missense probably damaging 0.98
R0056:Otoa UTSW 7 121131347 missense probably benign 0.00
R0279:Otoa UTSW 7 121111079 splice site probably benign
R0390:Otoa UTSW 7 121131341 missense probably benign 0.07
R0411:Otoa UTSW 7 121156527 critical splice donor site probably null
R0628:Otoa UTSW 7 121145650 splice site probably benign
R1113:Otoa UTSW 7 121125443 nonsense probably null
R1240:Otoa UTSW 7 121156490 missense probably benign
R1308:Otoa UTSW 7 121125443 nonsense probably null
R1692:Otoa UTSW 7 121091551 missense probably damaging 0.99
R1728:Otoa UTSW 7 121125439 missense probably benign 0.36
R1729:Otoa UTSW 7 121125439 missense probably benign 0.36
R1744:Otoa UTSW 7 121127776 splice site probably benign
R1759:Otoa UTSW 7 121134103 missense probably damaging 1.00
R1784:Otoa UTSW 7 121125439 missense probably benign 0.36
R1817:Otoa UTSW 7 121160530 utr 3 prime probably benign
R1961:Otoa UTSW 7 121118569 missense probably benign 0.05
R2061:Otoa UTSW 7 121131328 missense probably damaging 1.00
R2509:Otoa UTSW 7 121160472 missense probably benign
R2510:Otoa UTSW 7 121160472 missense probably benign
R3411:Otoa UTSW 7 121122043 missense probably damaging 1.00
R3438:Otoa UTSW 7 121160343 missense possibly damaging 0.80
R3905:Otoa UTSW 7 121125565 missense probably damaging 1.00
R3907:Otoa UTSW 7 121125565 missense probably damaging 1.00
R4613:Otoa UTSW 7 121145568 missense probably damaging 1.00
R4751:Otoa UTSW 7 121132924 critical splice donor site probably benign
R4896:Otoa UTSW 7 121102679 missense probably damaging 1.00
R4932:Otoa UTSW 7 121155135 missense probably damaging 0.98
R5224:Otoa UTSW 7 121139793 missense probably damaging 0.98
R5235:Otoa UTSW 7 121156470 missense probably damaging 1.00
R5595:Otoa UTSW 7 121121977 missense probably damaging 1.00
R5891:Otoa UTSW 7 121132360 splice site probably null
R5894:Otoa UTSW 7 121121869 missense probably damaging 1.00
R5905:Otoa UTSW 7 121094601 missense probably damaging 1.00
R5976:Otoa UTSW 7 121127713 missense probably benign 0.00
R6464:Otoa UTSW 7 121102605 missense probably damaging 1.00
R6761:Otoa UTSW 7 121121950 missense probably damaging 1.00
R6770:Otoa UTSW 7 121145614 missense probably benign 0.25
R6821:Otoa UTSW 7 121092847 critical splice donor site probably null
R6924:Otoa UTSW 7 121131501 intron probably null
R7016:Otoa UTSW 7 121147766 missense probably damaging 0.99
R7215:Otoa UTSW 7 121118572 missense unknown
R7313:Otoa UTSW 7 121102542 missense probably benign 0.42
R7340:Otoa UTSW 7 121130065 missense probably benign 0.38
R7443:Otoa UTSW 7 121132410 missense probably benign 0.00
R7559:Otoa UTSW 7 121143926 missense probably damaging 0.99
R7640:Otoa UTSW 7 121145626 missense probably damaging 1.00
R7659:Otoa UTSW 7 121134044 missense probably benign 0.01
U24488:Otoa UTSW 7 121118540 critical splice acceptor site probably null
X0023:Otoa UTSW 7 121118571 missense probably benign 0.00
Z1177:Otoa UTSW 7 121118655 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTACATTAGGGATTAGGTCTCAGTG -3'
(R):5'- AACGACAATGATGATGGAGTCTTTAGC -3'

Sequencing Primer
(F):5'- ATTAGGTCTCAGTGATGGATTTTGG -3'
(R):5'- ATGATGGAGTCTTTAGCGAGGAC -3'
Posted On2019-11-12