Incidental Mutation 'R1395:Col20a1'
Institutional Source Beutler Lab
Gene Symbol Col20a1
Ensembl Gene ENSMUSG00000016356
Gene Namecollagen, type XX, alpha 1
MMRRC Submission 039457-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1395 (G1)
Quality Score225
Status Validated
Chromosomal Location180986535-181018363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 180998607 bp
Amino Acid Change Valine to Glutamic Acid at position 519 (V519E)
Ref Sequence ENSEMBL: ENSMUSP00000115291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108856] [ENSMUST00000149179] [ENSMUST00000228434]
Predicted Effect probably damaging
Transcript: ENSMUST00000108856
AA Change: V561E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104484
Gene: ENSMUSG00000016356
AA Change: V561E

signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
Pfam:Collagen 1067 1125 3.8e-9 PFAM
Pfam:Collagen 1122 1174 7.4e-9 PFAM
Pfam:Collagen 1165 1223 3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149179
AA Change: V519E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115291
Gene: ENSMUSG00000016356
AA Change: V519E

signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
low complexity region 1069 1106 N/A INTRINSIC
low complexity region 1108 1121 N/A INTRINSIC
low complexity region 1136 1155 N/A INTRINSIC
Blast:TSPN 1156 1202 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152473
Predicted Effect possibly damaging
Transcript: ENSMUST00000228434
AA Change: V519E

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.5353 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
4932431P20Rik T A 7: 29,531,387 noncoding transcript Het
A330070K13Rik A G 5: 130,379,141 probably benign Het
Abcc2 A G 19: 43,833,940 R1406G probably benign Het
Adgrv1 G T 13: 81,386,788 T5786K probably benign Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Arhgap11a C T 2: 113,833,122 V939I probably benign Het
Arhgap12 T C 18: 6,037,058 N561S probably benign Het
Arhgef12 T C 9: 43,005,870 H391R probably damaging Het
Asb3 T C 11: 31,101,032 probably benign Het
C2cd5 T C 6: 143,061,738 probably benign Het
Ccdc85a T C 11: 28,583,412 K44R possibly damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Cylc2 A G 4: 51,228,366 K146E possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Eef1a1 C T 9: 78,479,018 V402I probably benign Het
Esyt3 T C 9: 99,316,782 probably benign Het
Extl3 A G 14: 65,077,496 V79A possibly damaging Het
Fat3 C T 9: 16,246,916 V1133I probably benign Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fdxacb1 TAGAC T 9: 50,772,496 probably null Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gm8374 G T 14: 7,364,174 N55K probably benign Het
Gria1 T A 11: 57,283,566 I558N probably damaging Het
Gse1 G T 8: 120,574,999 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hectd4 T C 5: 121,328,513 probably null Het
Herc1 T C 9: 66,439,181 I1943T probably benign Het
Ift172 T C 5: 31,285,238 probably benign Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Lactb T C 9: 66,971,379 probably benign Het
Map1a C T 2: 121,303,925 H1741Y probably benign Het
Map1lc3b T C 8: 121,596,720 Y110H probably benign Het
Mlh1 T C 9: 111,247,377 D304G probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Ncoa4 T A 14: 32,172,841 probably null Het
Neto1 T C 18: 86,398,019 probably benign Het
Nf1 T C 11: 79,535,983 V1741A possibly damaging Het
Nkain2 C A 10: 32,890,189 probably benign Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Olfr564 G A 7: 102,804,207 C243Y possibly damaging Het
Olfr615 T C 7: 103,561,119 L214P possibly damaging Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Prrxl1 C T 14: 32,608,369 P148S probably benign Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Ralgapa2 T G 2: 146,388,500 K963N probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Sag G A 1: 87,828,441 V257I probably benign Het
Scaf1 T C 7: 45,008,297 E386G probably damaging Het
Slc4a10 A G 2: 62,313,286 E1055G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Tgm2 T A 2: 158,124,252 H494L probably benign Het
Tub C T 7: 109,020,954 R102* probably null Het
Ugt3a1 T G 15: 9,306,292 L176V possibly damaging Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfp322a C T 13: 23,356,775 V266I probably benign Het
Zfp663 T C 2: 165,352,572 R576G probably damaging Het
Other mutations in Col20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Col20a1 APN 2 181003479 missense possibly damaging 0.93
IGL00975:Col20a1 APN 2 180992478 missense probably damaging 1.00
IGL01094:Col20a1 APN 2 180999766 missense probably damaging 0.99
IGL01388:Col20a1 APN 2 181003471 missense probably benign 0.24
IGL01472:Col20a1 APN 2 181007832 missense probably benign 0.44
IGL01936:Col20a1 APN 2 181009368 splice site probably benign
IGL02133:Col20a1 APN 2 181007144 missense probably damaging 1.00
IGL02318:Col20a1 APN 2 181007159 missense probably damaging 0.99
IGL02576:Col20a1 APN 2 181013405 nonsense probably null
IGL02822:Col20a1 APN 2 180996807 missense probably damaging 1.00
IGL02898:Col20a1 APN 2 180989112 nonsense probably null
IGL03056:Col20a1 APN 2 180994889 missense probably damaging 1.00
IGL03189:Col20a1 APN 2 181009407 nonsense probably null
IGL03196:Col20a1 APN 2 181007878 splice site probably null
R0001:Col20a1 UTSW 2 180984412 unclassified probably benign
R0200:Col20a1 UTSW 2 181000438 missense probably damaging 1.00
R0384:Col20a1 UTSW 2 180999162 missense probably benign 0.00
R0964:Col20a1 UTSW 2 180984485 unclassified probably benign
R0975:Col20a1 UTSW 2 181006826 missense possibly damaging 0.75
R1359:Col20a1 UTSW 2 180999792 missense probably benign 0.02
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1508:Col20a1 UTSW 2 180992577 missense probably damaging 0.98
R1865:Col20a1 UTSW 2 181015813 missense possibly damaging 0.87
R1883:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1884:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1906:Col20a1 UTSW 2 180998697 missense probably benign 0.00
R2020:Col20a1 UTSW 2 181013163 critical splice donor site probably null
R2121:Col20a1 UTSW 2 180996456 missense probably damaging 0.99
R2131:Col20a1 UTSW 2 180992573 missense probably damaging 1.00
R2343:Col20a1 UTSW 2 181001331 missense possibly damaging 0.73
R3153:Col20a1 UTSW 2 181008593 missense probably damaging 1.00
R3430:Col20a1 UTSW 2 181013285 nonsense probably null
R3547:Col20a1 UTSW 2 180994911 missense probably damaging 1.00
R3844:Col20a1 UTSW 2 180992449 missense probably damaging 1.00
R3914:Col20a1 UTSW 2 180998492 missense probably benign 0.00
R4414:Col20a1 UTSW 2 181001250 missense possibly damaging 0.92
R4711:Col20a1 UTSW 2 180992491 missense probably damaging 1.00
R4760:Col20a1 UTSW 2 180984403 unclassified probably benign
R4771:Col20a1 UTSW 2 180989124 missense probably benign 0.17
R4809:Col20a1 UTSW 2 180998661 missense probably damaging 1.00
R4872:Col20a1 UTSW 2 180997363 missense possibly damaging 0.74
R5045:Col20a1 UTSW 2 181006845 missense probably damaging 1.00
R5238:Col20a1 UTSW 2 180998586 missense probably damaging 1.00
R5566:Col20a1 UTSW 2 180986523 unclassified probably null
R6389:Col20a1 UTSW 2 180992583 splice site probably null
R6422:Col20a1 UTSW 2 181014819 missense possibly damaging 0.75
R6924:Col20a1 UTSW 2 180996850 missense probably damaging 1.00
R6982:Col20a1 UTSW 2 180996706 missense probably benign 0.00
R7177:Col20a1 UTSW 2 180994214 nonsense probably null
R7195:Col20a1 UTSW 2 181007231 missense probably damaging 1.00
R7717:Col20a1 UTSW 2 181007615 missense probably damaging 1.00
R7872:Col20a1 UTSW 2 180986578 missense probably benign 0.14
R8183:Col20a1 UTSW 2 180998414 missense
R8188:Col20a1 UTSW 2 181016333 critical splice donor site probably null
R8331:Col20a1 UTSW 2 180996766 missense possibly damaging 0.95
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ggggaggagcaaaagagag -3'
(R):5'- tcacctaaagccatccaaacc -3'
Posted On2014-03-17