Mutagenetix > Incidental Mutation

Incidental Mutation 'R1471:Itga4'

164851

Institutional Source

Beutler Lab

Gene Symbol

Itga4

Ensembl Gene

ENSMUSG00000027009

Gene Name

integrin alpha 4

Synonyms

VLA-4 receptor, alpha 4 subunit

MMRRC Submission

039524-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1471 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79255426-79333123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79287032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 394 (D394G)

Ref Sequence

ENSEMBL: ENSMUSP00000099718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099972]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000099972
AA Change: D394G

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000099718
Gene: ENSMUSG00000027009
AA Change: D394G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Int_alpha	48	108	5.14e-7	SMART
Int_alpha	191	241	3.45e1	SMART
Int_alpha	247	300	1.89e-5	SMART
Int_alpha	302	358	2.25e-12	SMART
Int_alpha	364	419	1.45e-15	SMART
Int_alpha	426	483	4.52e-3	SMART
SCOP:d1m1xa2	627	770	1e-35	SMART
Blast:Int_alpha	639	676	9e-16	BLAST
SCOP:d1m1xa3	773	948	7e-42	SMART
transmembrane domain	978	1000	N/A	INTRINSIC
PDB:4HKC\|B	1003	1032	1e-13	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126312

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135919

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 4 subunit. This subunit associates with a beta 1 or beta 7 subunit to form an integrin that may play a role in cell motility and migration. This integrin is a therapeutic target for the treatment of multiple sclerosis, Crohn's disease and inflammatory bowel disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit embryonic lethality either due to failure of chorioallantoic fusion or cardiac abnormalities, including hemorrhage around the heart and defects in epicardium formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,222	M255K	probably damaging	Het
4930486L24Rik	C	A	13: 60,853,522	K130N	probably damaging	Het
Adam6a	T	A	12: 113,544,393	S129T	probably damaging	Het
Adamts10	T	A	17: 33,553,138	F1087I	probably damaging	Het
Afp	T	A	5: 90,503,682	N385K	possibly damaging	Het
Ahnak	T	G	19: 9,012,932		probably benign	Het
Akap6	A	G	12: 53,141,496	T1898A	probably benign	Het
Antxr2	C	A	5: 97,975,340	V283F	possibly damaging	Het
Asgr1	T	C	11: 70,056,093	V55A	possibly damaging	Het
Asxl3	A	G	18: 22,516,354	K467E	probably damaging	Het
Atp5a1	C	A	18: 77,781,269	Q398K	probably damaging	Het
Atxn2	T	A	5: 121,786,374	D455E	probably damaging	Het
B4galt6	C	T	18: 20,745,353	A39T	possibly damaging	Het
C130073F10Rik	C	T	4: 101,890,338	E165K	probably benign	Het
Cabin1	A	G	10: 75,694,792	C1519R	probably damaging	Het
Casp8ap2	C	T	4: 32,639,386	R147*	probably null	Het
Ccdc109b	T	A	3: 129,915,815	Y283F	probably damaging	Het
Ccdc88b	A	G	19: 6,854,023	L517P	probably benign	Het
Cd109	G	A	9: 78,654,587	V220I	probably damaging	Het
Cd2ap	T	C	17: 42,820,597	K369R	probably benign	Het
Cd300c	A	G	11: 114,959,788	V63A	probably benign	Het
Cnot10	A	G	9: 114,591,551	V741A	probably benign	Het
Col18a1	G	T	10: 77,096,206	Q350K	unknown	Het
Crnkl1	T	C	2: 145,932,316	K76E	possibly damaging	Het
Cryzl2	A	G	1: 157,470,721	K227E	probably benign	Het
Cts6	G	A	13: 61,196,380	T286I	probably benign	Het
Cul1	T	C	6: 47,514,886	V392A	probably damaging	Het
Dcaf7	T	A	11: 106,046,747	F65L	probably benign	Het
Dgke	A	C	11: 89,055,494	V160G	possibly damaging	Het
Dock8	C	A	19: 25,201,036	Q2098K	possibly damaging	Het
Efhb	T	A	17: 53,399,112	D799V	possibly damaging	Het
Ephb2	T	C	4: 136,658,951	D829G	probably benign	Het
Exosc1	A	T	19: 41,924,718	S117R	probably damaging	Het
Fga	T	C	3: 83,028,618	S51P	probably benign	Het
Fmn1	T	C	2: 113,693,094	F1141L	possibly damaging	Het
Foxm1	C	T	6: 128,373,874	L713F	probably damaging	Het
Galnt4	A	G	10: 99,108,674	E87G	probably benign	Het
Gamt	T	C	10: 80,260,858	D15G	probably benign	Het
Gm13101	T	C	4: 143,964,953	N400S	probably benign	Het
Gm15557	C	A	2: 155,942,254	D154E	possibly damaging	Het
Gnptab	A	G	10: 88,445,763	I1211V	probably benign	Het
Greb1	A	T	12: 16,711,774	M535K	probably damaging	Het
Grm8	C	A	6: 27,363,309	A736S	possibly damaging	Het
Hspa14	T	C	2: 3,491,608	I373M	probably benign	Het
Ifi207	T	A	1: 173,730,063	T370S	unknown	Het
Igf1r	A	G	7: 68,003,837	N41S	probably damaging	Het
Ikzf5	A	T	7: 131,391,767	V224D	probably damaging	Het
Il10	C	A	1: 131,021,373	Y90*	probably null	Het
Kif21a	A	T	15: 90,956,419	S1165T	probably benign	Het
Krtap14	A	G	16: 88,825,627	S155P	probably damaging	Het
Loxl2	A	G	14: 69,693,097	N770S	probably benign	Het
Man2b1	A	G	8: 85,086,845	D222G	probably damaging	Het
Meis3	T	A	7: 16,177,571	Y64*	probably null	Het
Mfsd6	T	A	1: 52,709,557	I50F	probably benign	Het
Micu2	T	C	14: 57,945,397	T165A	probably damaging	Het
Mtcl1	T	C	17: 66,379,148	E921G	probably damaging	Het
Muc5b	A	T	7: 141,843,234	N215Y	unknown	Het
Muc6	A	G	7: 141,647,909	F772L	possibly damaging	Het
Myt1	A	G	2: 181,797,111	D142G	probably benign	Het
Nol6	C	T	4: 41,120,281	V479I	probably benign	Het
Nsun7	A	G	5: 66,284,229	K414E	probably benign	Het
Nup210l	A	C	3: 90,170,562	I914L	probably benign	Het
Obox3	G	A	7: 15,626,950	P88L	probably benign	Het
Olfr1098	C	T	2: 86,922,578		probably null	Het
Olfr1122	A	G	2: 87,388,518	Y271C	probably damaging	Het
Olfr1132	T	C	2: 87,635,670	T26A	probably benign	Het
Olfr1289	T	C	2: 111,484,006	L192P	probably damaging	Het
Pclo	T	C	5: 14,680,427		probably benign	Het
Pcsk5	T	C	19: 17,568,324	N745D	probably damaging	Het
Pdzrn3	T	A	6: 101,151,512	N731I	possibly damaging	Het
Pkdrej	T	A	15: 85,817,133	Q1534L	probably benign	Het
Rell1	T	A	5: 63,936,085	D109V	probably damaging	Het
Rplp0	C	T	5: 115,563,344	T285I	probably damaging	Het
Sema3g	C	T	14: 31,228,045	R728C	probably damaging	Het
Slc15a2	A	G	16: 36,753,791	Y536H	probably damaging	Het
Slc26a5	T	A	5: 21,816,964	Y488F	probably benign	Het
Slc5a4a	A	T	10: 76,186,528	S566C	probably damaging	Het
Spink7	C	T	18: 62,596,204	E21K	possibly damaging	Het
Src	C	T	2: 157,457,187	Q35*	probably null	Het
Srrm2	T	A	17: 23,820,796	V2234E	probably damaging	Het
Stk36	A	T	1: 74,611,155	Q282L	probably benign	Het
Tas2r118	T	G	6: 23,969,171	E297A	probably damaging	Het
Terf1	A	G	1: 15,842,970	Y385C	probably damaging	Het
Tmc3	T	C	7: 83,598,290	S198P	probably damaging	Het
Tmprss11b	C	T	5: 86,660,496	R407H	possibly damaging	Het
Tspyl4	G	A	10: 34,298,111	E200K	probably damaging	Het
Ttc21a	T	C	9: 119,942,641	Y169H	probably damaging	Het
Ugt2b36	C	T	5: 87,092,071	D152N	probably damaging	Het
Unk	T	C	11: 116,049,409	I196T	probably benign	Het
Uroc1	T	G	6: 90,344,171	V243G	probably damaging	Het
Usp34	C	A	11: 23,488,862	Q3475K	probably benign	Het
Vmn2r117	T	A	17: 23,478,473	I82L	probably benign	Het
Vmn2r44	A	T	7: 8,377,883	V337E	probably damaging	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp362	T	C	4: 128,787,200	T111A	probably benign	Het
Zfp598	T	C	17: 24,680,072	V615A	probably benign	Het

Other mutations in Itga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Itga4	APN	2	79292050	missense	probably benign	0.01
IGL01317:Itga4	APN	2	79322661	nonsense	probably null
IGL01545:Itga4	APN	2	79315970	splice site	probably benign
IGL01570:Itga4	APN	2	79322634	critical splice acceptor site	probably null
IGL01575:Itga4	APN	2	79288255	missense	probably damaging	1.00
IGL01837:Itga4	APN	2	79315005	missense	probably damaging	1.00
IGL01974:Itga4	APN	2	79273127	splice site	probably benign
IGL02087:Itga4	APN	2	79292069	missense	probably damaging	0.99
IGL02245:Itga4	APN	2	79320559	missense	probably benign	0.01
IGL02492:Itga4	APN	2	79255657	utr 5 prime	probably benign
IGL02809:Itga4	APN	2	79280577	missense	probably damaging	1.00
IGL02998:Itga4	APN	2	79277821	missense	possibly damaging	0.88
IGL03008:Itga4	APN	2	79325638	missense	probably benign
IGL03282:Itga4	APN	2	79325594	missense	probably damaging	0.98
IGL03285:Itga4	APN	2	79279166	missense	possibly damaging	0.48
IGL03286:Itga4	APN	2	79289362	missense	probably damaging	1.00
R0001:Itga4	UTSW	2	79326587	missense	probably damaging	0.99
R0045:Itga4	UTSW	2	79301031	missense	probably damaging	1.00
R0276:Itga4	UTSW	2	79321493	missense	probably damaging	0.99
R0554:Itga4	UTSW	2	79279117	missense	probably damaging	1.00
R0556:Itga4	UTSW	2	79325639	missense	probably benign
R0785:Itga4	UTSW	2	79289305	missense	possibly damaging	0.89
R0787:Itga4	UTSW	2	79279153	missense	probably benign	0.01
R1013:Itga4	UTSW	2	79320503	missense	probably benign	0.00
R1237:Itga4	UTSW	2	79279146	missense	probably null	0.08
R1295:Itga4	UTSW	2	79322689	missense	possibly damaging	0.82
R1559:Itga4	UTSW	2	79315688	missense	probably benign	0.04
R1769:Itga4	UTSW	2	79315706	critical splice donor site	probably null
R1931:Itga4	UTSW	2	79313844	critical splice donor site	probably null
R2012:Itga4	UTSW	2	79277794	missense	probably damaging	1.00
R2241:Itga4	UTSW	2	79301013	missense	probably damaging	1.00
R3793:Itga4	UTSW	2	79279128	missense	probably benign	0.01
R4133:Itga4	UTSW	2	79322652	missense	probably damaging	1.00
R4204:Itga4	UTSW	2	79279161	missense	probably damaging	0.97
R4296:Itga4	UTSW	2	79272799	missense	probably damaging	1.00
R4777:Itga4	UTSW	2	79313710	missense	possibly damaging	0.87
R4906:Itga4	UTSW	2	79288248	missense	probably damaging	1.00
R5048:Itga4	UTSW	2	79273034	missense	probably benign	0.04
R5087:Itga4	UTSW	2	79315629	missense	possibly damaging	0.95
R5212:Itga4	UTSW	2	79280595	missense	probably damaging	1.00
R5213:Itga4	UTSW	2	79320576	missense	probably benign	0.29
R5421:Itga4	UTSW	2	79316041	nonsense	probably null
R5549:Itga4	UTSW	2	79256267	missense	probably damaging	0.98
R5907:Itga4	UTSW	2	79322656	missense	probably benign
R5917:Itga4	UTSW	2	79287098	missense	probably damaging	1.00
R6309:Itga4	UTSW	2	79279085	missense	probably damaging	1.00
R6764:Itga4	UTSW	2	79325614	missense	probably benign	0.02
R6787:Itga4	UTSW	2	79289265	missense	probably damaging	0.97
R6790:Itga4	UTSW	2	79325614	missense	probably benign	0.02
R7051:Itga4	UTSW	2	79318126	missense	possibly damaging	0.91
R7311:Itga4	UTSW	2	79256182	missense	probably benign
R7520:Itga4	UTSW	2	79300989	missense	probably damaging	1.00
R7573:Itga4	UTSW	2	79272993	missense	probably benign
R7636:Itga4	UTSW	2	79313832	missense	probably benign	0.01
R7889:Itga4	UTSW	2	79316045	missense	probably benign	0.05
R8123:Itga4	UTSW	2	79315683	missense	probably benign
R8284:Itga4	UTSW	2	79321439	missense	probably benign	0.00
R8445:Itga4	UTSW	2	79281781	missense	probably benign
R8553:Itga4	UTSW	2	79301061	missense	probably damaging	0.97
R8696:Itga4	UTSW	2	79281781	missense	probably benign
R8900:Itga4	UTSW	2	79314988	missense	probably damaging	1.00
R8922:Itga4	UTSW	2	79255594	utr 5 prime	probably benign
R9359:Itga4	UTSW	2	79325660	missense	possibly damaging	0.48
R9403:Itga4	UTSW	2	79325660	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- TGCTGCAAAACCACCCACTCTG -3'
(R):5'- AGAGAGACAACAAGTCCACGTTACCA -3'

Sequencing Primer
(F):5'- aagaagtggaagtgggtgg -3'
(R):5'- CGTTACCAGACAAATACTGAGGG -3'

Posted On

2014-03-28