Mutagenetix > Incidental Mutations

Incidental Mutation 'R7051:Itga4'

547559

Institutional Source

Beutler Lab

Gene Symbol

Itga4

Ensembl Gene

ENSMUSG00000027009

Gene Name

integrin alpha 4

Synonyms

VLA-4 receptor, alpha 4 subunit

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7051 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79255426-79333123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79318126 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 788 (V788A)

Ref Sequence

ENSEMBL: ENSMUSP00000099718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099972]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099972
AA Change: V788A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099718
Gene: ENSMUSG00000027009
AA Change: V788A

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Int_alpha	48	108	5.14e-7	SMART
Int_alpha	191	241	3.45e1	SMART
Int_alpha	247	300	1.89e-5	SMART
Int_alpha	302	358	2.25e-12	SMART
Int_alpha	364	419	1.45e-15	SMART
Int_alpha	426	483	4.52e-3	SMART
SCOP:d1m1xa2	627	770	1e-35	SMART
Blast:Int_alpha	639	676	9e-16	BLAST
SCOP:d1m1xa3	773	948	7e-42	SMART
transmembrane domain	978	1000	N/A	INTRINSIC
PDB:4HKC\|B	1003	1032	1e-13	PDB

Meta Mutation Damage Score

0.2361

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

95% (80/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 4 subunit. This subunit associates with a beta 1 or beta 7 subunit to form an integrin that may play a role in cell motility and migration. This integrin is a therapeutic target for the treatment of multiple sclerosis, Crohn's disease and inflammatory bowel disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit embryonic lethality either due to failure of chorioallantoic fusion or cardiac abnormalities, including hemorrhage around the heart and defects in epicardium formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5930422O12Rik	C	T	8: 33,429,173	S7L	unknown	Het
Aggf1	T	C	13: 95,351,617	K674R	possibly damaging	Het
Ampd1	T	C	3: 103,090,073	F264L	probably damaging	Het
Ankle1	A	T	8: 71,407,743	S302C	probably damaging	Het
Ankrd17	G	A	5: 90,366,451		probably benign	Het
Arhgap18	T	A	10: 26,849,921	N47K	possibly damaging	Het
Atp5f1	T	C	3: 105,943,767	N205D	probably benign	Het
Atp8b3	C	T	10: 80,520,024	E1285K	probably benign	Het
Atp8b3	C	A	10: 80,529,718	V401L	probably damaging	Het
Cacna1a	G	A	8: 84,629,915	R1929Q	possibly damaging	Het
Cadm2	C	T	16: 66,882,879	S22N	possibly damaging	Het
Ccdc177	C	T	12: 80,759,153	V116M	probably damaging	Het
Cdkl2	A	T	5: 92,033,225	I185N	probably damaging	Het
Cfhr2	T	A	1: 139,810,978	I282L	probably benign	Het
Clns1a	T	A	7: 97,712,617		probably null	Het
Commd2	A	T	3: 57,646,686	I198N	probably damaging	Het
Creb3l2	C	T	6: 37,336,265	V365I	possibly damaging	Het
Dcaf6	A	T	1: 165,424,317	N79K	possibly damaging	Het
Dlg5	T	C	14: 24,146,195	N1622D	possibly damaging	Het
Dock7	C	T	4: 98,946,732	R1802H	probably damaging	Het
Dpy19l2	T	C	9: 24,584,493	K643R	probably benign	Het
Dscam	G	A	16: 96,819,786	T574M	probably benign	Het
Fam209	A	G	2: 172,474,049	T115A	probably damaging	Het
Fastkd5	C	T	2: 130,614,417	C751Y	probably damaging	Het
Fat3	C	A	9: 16,377,827	L133F	probably damaging	Het
Frmd6	T	C	12: 70,897,396	V516A	possibly damaging	Het
Fry	G	A	5: 150,395,169	D955N	possibly damaging	Het
Fuk	A	T	8: 110,890,339	I393N	probably damaging	Het
Gm281	A	G	14: 13,828,486	V758A		Het
Gm340	A	G	19: 41,585,752	D982G	probably benign	Het
Gm7298	T	C	6: 121,775,034		probably null	Het
Golga7b	T	A	19: 42,268,460	*168R	probably null	Het
Golim4	T	A	3: 75,893,002	Q395L	probably benign	Het
Gxylt2	T	A	6: 100,804,576	L404*	probably null	Het
Hist1h1e	A	G	13: 23,622,439	V20A	probably benign	Het
Ighmbp2	G	T	19: 3,261,462	S984R	probably damaging	Het
Irf8	C	T	8: 120,739,842	R9W	probably damaging	Het
Kifap3	G	A	1: 163,794,080	R99H	probably damaging	Het
Kiss1r	T	C	10: 79,918,854	S61P	probably damaging	Het
Krtap6-1	A	T	16: 89,031,718	M1L	unknown	Het
Large2	A	T	2: 92,367,022	M411K	probably damaging	Het
Lingo1	A	G	9: 56,620,183	V374A	probably benign	Het
Lrch1	A	G	14: 74,785,522	V637A	probably damaging	Het
Lyar	T	C	5: 38,224,680	V2A	probably damaging	Het
Nell1	C	T	7: 50,448,844	S298L	unknown	Het
Ogfod3	T	A	11: 121,195,205	I188F	probably damaging	Het
Olfr1487	T	A	19: 13,619,405	M81K	possibly damaging	Het
Olfr173	T	C	16: 58,797,175	T224A	probably benign	Het
Opa3	C	A	7: 19,245,036	A142E	possibly damaging	Het
Pald1	T	C	10: 61,323,346	R769G	probably benign	Het
Pappa2	T	A	1: 158,957,183	T86S	unknown	Het
Papss1	T	C	3: 131,602,050	Y266H	probably damaging	Het
Pcdhga7	C	A	18: 37,716,941	A667D	probably damaging	Het
Pcsk5	T	A	19: 17,433,731	T1766S	probably benign	Het
Pds5b	T	A	5: 150,794,282	N1129K	possibly damaging	Het
Pop7	T	C	5: 137,501,690	N127S	probably damaging	Het
Ppfibp2	A	G	7: 107,717,718	E300G	probably damaging	Het
Ppp4r3b	A	G	11: 29,182,507	K87E	probably damaging	Het
Psmd3	T	A	11: 98,682,833	M35K	possibly damaging	Het
Pus7	A	G	5: 23,775,679	V191A	probably damaging	Het
Rptor	C	T	11: 119,874,186		probably benign	Het
Sacs	A	G	14: 61,208,928	M2808V	probably benign	Het
Scube3	G	A	17: 28,167,599	V831I	probably benign	Het
Sin3a	A	T	9: 57,103,934	N492Y	probably damaging	Het
Slc12a3	A	G	8: 94,365,944	T998A	probably damaging	Het
Slc4a1	T	C	11: 102,356,258	N501S	probably benign	Het
Sltm	G	A	9: 70,559,066	G94R	probably damaging	Het
Smc4	T	A	3: 69,027,502	W650R	probably damaging	Het
Smg7	A	G	1: 152,848,850	S527P	probably damaging	Het
Tcf20	T	C	15: 82,856,078	N391D	probably damaging	Het
Tiam2	G	A	17: 3,448,483	V845M	probably damaging	Het
Tln2	A	G	9: 67,346,417	F793L	probably benign	Het
Uckl1	T	C	2: 181,574,244	I193V	probably damaging	Het
Ugt1a5	A	G	1: 88,166,355	M102V	probably benign	Het
Usp38	G	A	8: 81,001,121	P328S	possibly damaging	Het
Vmn1r189	A	G	13: 22,102,115	V184A	possibly damaging	Het
Vps13d	C	A	4: 145,163,344	A597S	probably benign	Het
Wdr47	T	A	3: 108,618,524	L121Q	probably damaging	Het
Wiz	A	G	17: 32,361,533	S315P	probably damaging	Het
Zc3h13	T	C	14: 75,331,157	S1297P	probably damaging	Het
Zfp27	AATCCGCTTGTGCA	AA	7: 29,895,021		probably benign	Het

Other mutations in Itga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Itga4	APN	2	79292050	missense	probably benign	0.01
IGL01317:Itga4	APN	2	79322661	nonsense	probably null
IGL01545:Itga4	APN	2	79315970	splice site	probably benign
IGL01570:Itga4	APN	2	79322634	critical splice acceptor site	probably null
IGL01575:Itga4	APN	2	79288255	missense	probably damaging	1.00
IGL01837:Itga4	APN	2	79315005	missense	probably damaging	1.00
IGL01974:Itga4	APN	2	79273127	splice site	probably benign
IGL02087:Itga4	APN	2	79292069	missense	probably damaging	0.99
IGL02245:Itga4	APN	2	79320559	missense	probably benign	0.01
IGL02492:Itga4	APN	2	79255657	utr 5 prime	probably benign
IGL02809:Itga4	APN	2	79280577	missense	probably damaging	1.00
IGL02998:Itga4	APN	2	79277821	missense	possibly damaging	0.88
IGL03008:Itga4	APN	2	79325638	missense	probably benign
IGL03282:Itga4	APN	2	79325594	missense	probably damaging	0.98
IGL03285:Itga4	APN	2	79279166	missense	possibly damaging	0.48
IGL03286:Itga4	APN	2	79289362	missense	probably damaging	1.00
R0001:Itga4	UTSW	2	79326587	missense	probably damaging	0.99
R0045:Itga4	UTSW	2	79301031	missense	probably damaging	1.00
R0276:Itga4	UTSW	2	79321493	missense	probably damaging	0.99
R0554:Itga4	UTSW	2	79279117	missense	probably damaging	1.00
R0556:Itga4	UTSW	2	79325639	missense	probably benign
R0785:Itga4	UTSW	2	79289305	missense	possibly damaging	0.89
R0787:Itga4	UTSW	2	79279153	missense	probably benign	0.01
R1013:Itga4	UTSW	2	79320503	missense	probably benign	0.00
R1237:Itga4	UTSW	2	79279146	missense	probably null	0.08
R1295:Itga4	UTSW	2	79322689	missense	possibly damaging	0.82
R1471:Itga4	UTSW	2	79287032	missense	probably benign	0.26
R1559:Itga4	UTSW	2	79315688	missense	probably benign	0.04
R1769:Itga4	UTSW	2	79315706	critical splice donor site	probably null
R1931:Itga4	UTSW	2	79313844	critical splice donor site	probably null
R2012:Itga4	UTSW	2	79277794	missense	probably damaging	1.00
R2241:Itga4	UTSW	2	79301013	missense	probably damaging	1.00
R3793:Itga4	UTSW	2	79279128	missense	probably benign	0.01
R4133:Itga4	UTSW	2	79322652	missense	probably damaging	1.00
R4204:Itga4	UTSW	2	79279161	missense	probably damaging	0.97
R4296:Itga4	UTSW	2	79272799	missense	probably damaging	1.00
R4777:Itga4	UTSW	2	79313710	missense	possibly damaging	0.87
R4906:Itga4	UTSW	2	79288248	missense	probably damaging	1.00
R5048:Itga4	UTSW	2	79273034	missense	probably benign	0.04
R5087:Itga4	UTSW	2	79315629	missense	possibly damaging	0.95
R5212:Itga4	UTSW	2	79280595	missense	probably damaging	1.00
R5213:Itga4	UTSW	2	79320576	missense	probably benign	0.29
R5421:Itga4	UTSW	2	79316041	nonsense	probably null
R5549:Itga4	UTSW	2	79256267	missense	probably damaging	0.98
R5907:Itga4	UTSW	2	79322656	missense	probably benign
R5917:Itga4	UTSW	2	79287098	missense	probably damaging	1.00
R6309:Itga4	UTSW	2	79279085	missense	probably damaging	1.00
R6764:Itga4	UTSW	2	79325614	missense	probably benign	0.02
R6787:Itga4	UTSW	2	79289265	missense	probably damaging	0.97
R6790:Itga4	UTSW	2	79325614	missense	probably benign	0.02
R7311:Itga4	UTSW	2	79256182	missense	probably benign
R7520:Itga4	UTSW	2	79300989	missense	probably damaging	1.00
R7573:Itga4	UTSW	2	79272993	missense	probably benign
R7636:Itga4	UTSW	2	79313832	missense	probably benign	0.01
R7889:Itga4	UTSW	2	79316045	missense	probably benign	0.05
R7972:Itga4	UTSW	2	79316045	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GCAGGCAAGTGTATATATTGGC -3'
(R):5'- GCCCAATCACAGTACTGCAG -3'

Sequencing Primer
(F):5'- CTGAATAGGCATGGCTACCTG -3'
(R):5'- TCACAGTACTGCAGCCCCG -3'

Posted On

2019-05-13