Mutagenetix > Incidental Mutations

Incidental Mutation 'R1295:Itga4'

158043

Institutional Source

Beutler Lab

Gene Symbol

Itga4

Ensembl Gene

ENSMUSG00000027009

Gene Name

integrin alpha 4

Synonyms

VLA-4 receptor, alpha 4 subunit

MMRRC Submission

039361-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1295 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79255426-79333123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79322689 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 907 (M907V)

Ref Sequence

ENSEMBL: ENSMUSP00000099718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099972]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099972
AA Change: M907V

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099718
Gene: ENSMUSG00000027009
AA Change: M907V

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Int_alpha	48	108	5.14e-7	SMART
Int_alpha	191	241	3.45e1	SMART
Int_alpha	247	300	1.89e-5	SMART
Int_alpha	302	358	2.25e-12	SMART
Int_alpha	364	419	1.45e-15	SMART
Int_alpha	426	483	4.52e-3	SMART
SCOP:d1m1xa2	627	770	1e-35	SMART
Blast:Int_alpha	639	676	9e-16	BLAST
SCOP:d1m1xa3	773	948	7e-42	SMART
transmembrane domain	978	1000	N/A	INTRINSIC
PDB:4HKC\|B	1003	1032	1e-13	PDB

Meta Mutation Damage Score

0.1432

Coding Region Coverage

1x: 98.7%
3x: 97.4%
10x: 93.1%
20x: 82.0%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 4 subunit. This subunit associates with a beta 1 or beta 7 subunit to form an integrin that may play a role in cell motility and migration. This integrin is a therapeutic target for the treatment of multiple sclerosis, Crohn's disease and inflammatory bowel disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit embryonic lethality either due to failure of chorioallantoic fusion or cardiac abnormalities, including hemorrhage around the heart and defects in epicardium formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr2	A	G	9: 121,908,717	S53G	possibly damaging	Het
Adgrb1	T	A	15: 74,550,039	L886Q	probably damaging	Het
Adprhl1	G	A	8: 13,248,624	T102M	probably damaging	Het
Akap6	A	C	12: 52,887,029	K435Q	probably damaging	Het
Aldh7a1	T	C	18: 56,546,950		probably null	Het
Amfr	T	C	8: 93,974,804	R507G	probably benign	Het
Ap1m1	T	A	8: 72,251,875		probably null	Het
Arhgap29	A	G	3: 121,992,395	H275R	probably benign	Het
Arhgef17	C	A	7: 100,881,269	E428*	probably null	Het
Atm	A	T	9: 53,456,530	V2431E	probably damaging	Het
Atn1	G	T	6: 124,747,787	P161Q	unknown	Het
Atp13a2	T	C	4: 140,993,802	S99P	probably damaging	Het
Ccar1	C	A	10: 62,783,882		probably null	Het
Cdk18	T	C	1: 132,119,960		probably benign	Het
Cep85	A	G	4: 134,167,400	W32R	probably damaging	Het
Col5a3	A	G	9: 20,808,418	F215S	unknown	Het
Decr1	T	C	4: 15,919,207	N312S	possibly damaging	Het
Diaph3	A	T	14: 87,007,399	W178R	probably damaging	Het
Dync2h1	A	G	9: 7,075,752		probably benign	Het
Ehd3	C	A	17: 73,828,186	D352E	probably damaging	Het
Enpp6	T	G	8: 47,065,500	I221S	probably benign	Het
Fam186a	T	C	15: 99,939,789		probably benign	Het
Gm5435	G	T	12: 82,495,784		noncoding transcript	Het
Gm6990	T	A	19: 56,755,334		noncoding transcript	Het
Gpr22	A	C	12: 31,709,514	I203S	probably benign	Het
Gpr61	A	G	3: 108,150,481	V288A	possibly damaging	Het
Grik3	G	A	4: 125,704,564		probably benign	Het
Gstcd	T	C	3: 133,005,628	N431D	probably damaging	Het
Haao	T	A	17: 83,838,838	Q69L	probably benign	Het
Hist1h1b	T	C	13: 21,779,999	S186G	probably benign	Het
Ift140	G	T	17: 25,088,933		probably null	Het
Ikbke	A	G	1: 131,270,226	V381A	probably benign	Het
Ing1	A	C	8: 11,561,501	I38L	probably benign	Het
Ing1	T	A	8: 11,561,502	I38N	probably damaging	Het
Kcnk12	C	T	17: 87,746,373	G287D	probably damaging	Het
Kmt2e	A	C	5: 23,502,404	H1655P	probably damaging	Het
Mbtd1	A	G	11: 93,910,359	Y122C	probably damaging	Het
Mslnl	T	C	17: 25,743,240	L204P	probably damaging	Het
Muc6	T	C	7: 141,651,879	E112G	probably benign	Het
Nav3	T	A	10: 109,692,102	D2240V	probably damaging	Het
Ndufaf3	T	C	9: 108,566,693	T9A	probably damaging	Het
Numb	C	A	12: 83,796,161		probably benign	Het
Prodh2	T	C	7: 30,494,089	V79A	probably damaging	Het
Psmb2	A	G	4: 126,687,032	Y73C	probably damaging	Het
Rmnd5a	G	A	6: 71,398,455	L80F	probably benign	Het
Rnf19a	G	T	15: 36,244,101	Y604*	probably null	Het
Ros1	T	A	10: 52,087,932	E1744V	possibly damaging	Het
Rpusd2	T	C	2: 119,036,927	F219L	probably benign	Het
Sall2	T	C	14: 52,313,725	N671S	probably damaging	Het
Sele	T	A	1: 164,050,810	S239R	probably damaging	Het
Serpina3b	T	C	12: 104,130,879	F140L	probably damaging	Het
Stxbp1	A	T	2: 32,794,636	S594T	probably benign	Het
Sufu	G	A	19: 46,454,720		probably benign	Het
Tbx2	A	G	11: 85,834,766	E181G	probably damaging	Het
Thumpd2	A	G	17: 81,055,888	V50A	probably damaging	Het
Tmem56	A	G	3: 121,207,291	V231A	probably benign	Het
Ttn	C	A	2: 76,743,245	R17441L	probably damaging	Het
Usp34	A	G	11: 23,384,477	Y1157C	probably damaging	Het
Vmn1r9	T	C	6: 57,071,537	V199A	probably damaging	Het
Vmn2r6	A	G	3: 64,538,273	F677S	probably damaging	Het
Vmn2r84	C	T	10: 130,389,139	A501T	probably benign	Het
Wapl	C	T	14: 34,724,769	P605S	probably damaging	Het
Zfp598	A	G	17: 24,679,649	N474S	probably benign	Het
Zfyve26	A	G	12: 79,274,920	L975P	probably damaging	Het
Zp3r	C	T	1: 130,591,444	G255D	probably damaging	Het

Other mutations in Itga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Itga4	APN	2	79292050	missense	probably benign	0.01
IGL01317:Itga4	APN	2	79322661	nonsense	probably null
IGL01545:Itga4	APN	2	79315970	splice site	probably benign
IGL01570:Itga4	APN	2	79322634	critical splice acceptor site	probably null
IGL01575:Itga4	APN	2	79288255	missense	probably damaging	1.00
IGL01837:Itga4	APN	2	79315005	missense	probably damaging	1.00
IGL01974:Itga4	APN	2	79273127	splice site	probably benign
IGL02087:Itga4	APN	2	79292069	missense	probably damaging	0.99
IGL02245:Itga4	APN	2	79320559	missense	probably benign	0.01
IGL02492:Itga4	APN	2	79255657	utr 5 prime	probably benign
IGL02809:Itga4	APN	2	79280577	missense	probably damaging	1.00
IGL02998:Itga4	APN	2	79277821	missense	possibly damaging	0.88
IGL03008:Itga4	APN	2	79325638	missense	probably benign
IGL03282:Itga4	APN	2	79325594	missense	probably damaging	0.98
IGL03285:Itga4	APN	2	79279166	missense	possibly damaging	0.48
IGL03286:Itga4	APN	2	79289362	missense	probably damaging	1.00
R0001:Itga4	UTSW	2	79326587	missense	probably damaging	0.99
R0045:Itga4	UTSW	2	79301031	missense	probably damaging	1.00
R0276:Itga4	UTSW	2	79321493	missense	probably damaging	0.99
R0554:Itga4	UTSW	2	79279117	missense	probably damaging	1.00
R0556:Itga4	UTSW	2	79325639	missense	probably benign
R0785:Itga4	UTSW	2	79289305	missense	possibly damaging	0.89
R0787:Itga4	UTSW	2	79279153	missense	probably benign	0.01
R1013:Itga4	UTSW	2	79320503	missense	probably benign	0.00
R1237:Itga4	UTSW	2	79279146	missense	probably null	0.08
R1471:Itga4	UTSW	2	79287032	missense	probably benign	0.26
R1559:Itga4	UTSW	2	79315688	missense	probably benign	0.04
R1769:Itga4	UTSW	2	79315706	critical splice donor site	probably null
R1931:Itga4	UTSW	2	79313844	critical splice donor site	probably null
R2012:Itga4	UTSW	2	79277794	missense	probably damaging	1.00
R2241:Itga4	UTSW	2	79301013	missense	probably damaging	1.00
R3793:Itga4	UTSW	2	79279128	missense	probably benign	0.01
R4133:Itga4	UTSW	2	79322652	missense	probably damaging	1.00
R4204:Itga4	UTSW	2	79279161	missense	probably damaging	0.97
R4296:Itga4	UTSW	2	79272799	missense	probably damaging	1.00
R4777:Itga4	UTSW	2	79313710	missense	possibly damaging	0.87
R4906:Itga4	UTSW	2	79288248	missense	probably damaging	1.00
R5048:Itga4	UTSW	2	79273034	missense	probably benign	0.04
R5087:Itga4	UTSW	2	79315629	missense	possibly damaging	0.95
R5212:Itga4	UTSW	2	79280595	missense	probably damaging	1.00
R5213:Itga4	UTSW	2	79320576	missense	probably benign	0.29
R5421:Itga4	UTSW	2	79316041	nonsense	probably null
R5549:Itga4	UTSW	2	79256267	missense	probably damaging	0.98
R5907:Itga4	UTSW	2	79322656	missense	probably benign
R5917:Itga4	UTSW	2	79287098	missense	probably damaging	1.00
R6309:Itga4	UTSW	2	79279085	missense	probably damaging	1.00
R6764:Itga4	UTSW	2	79325614	missense	probably benign	0.02
R6787:Itga4	UTSW	2	79289265	missense	probably damaging	0.97
R6790:Itga4	UTSW	2	79325614	missense	probably benign	0.02
R7051:Itga4	UTSW	2	79318126	missense	possibly damaging	0.91
R7311:Itga4	UTSW	2	79256182	missense	probably benign
R7520:Itga4	UTSW	2	79300989	missense	probably damaging	1.00
R7573:Itga4	UTSW	2	79272993	missense	probably benign
R7636:Itga4	UTSW	2	79313832	missense	probably benign	0.01
R7889:Itga4	UTSW	2	79316045	missense	probably benign	0.05
R8123:Itga4	UTSW	2	79315683	missense	probably benign
R8284:Itga4	UTSW	2	79321439	missense	probably benign	0.00
R8445:Itga4	UTSW	2	79281781	missense	probably benign
R8553:Itga4	UTSW	2	79301061

Predicted Primers

PCR Primer
(F):5'- GCGTGGCAATCATTCTATCCACTGAAC -3'
(R):5'- CCTGGTGACTTAAGATGATGTGAGCTG -3'

Sequencing Primer
(F):5'- ACTGAACCATCTTCTCCAGC -3'
(R):5'- CCATTTCCAAGATGGATGGC -3'

Posted On

2014-02-18