Incidental Mutation 'R1295:Itga4'
ID158043
Institutional Source Beutler Lab
Gene Symbol Itga4
Ensembl Gene ENSMUSG00000027009
Gene Nameintegrin alpha 4
SynonymsVLA-4 receptor, alpha 4 subunit
MMRRC Submission 039361-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1295 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location79255426-79333123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79322689 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 907 (M907V)
Ref Sequence ENSEMBL: ENSMUSP00000099718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099972]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099972
AA Change: M907V

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099718
Gene: ENSMUSG00000027009
AA Change: M907V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Int_alpha 48 108 5.14e-7 SMART
Int_alpha 191 241 3.45e1 SMART
Int_alpha 247 300 1.89e-5 SMART
Int_alpha 302 358 2.25e-12 SMART
Int_alpha 364 419 1.45e-15 SMART
Int_alpha 426 483 4.52e-3 SMART
SCOP:d1m1xa2 627 770 1e-35 SMART
Blast:Int_alpha 639 676 9e-16 BLAST
SCOP:d1m1xa3 773 948 7e-42 SMART
transmembrane domain 978 1000 N/A INTRINSIC
PDB:4HKC|B 1003 1032 1e-13 PDB
Meta Mutation Damage Score 0.1432 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 4 subunit. This subunit associates with a beta 1 or beta 7 subunit to form an integrin that may play a role in cell motility and migration. This integrin is a therapeutic target for the treatment of multiple sclerosis, Crohn's disease and inflammatory bowel disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit embryonic lethality either due to failure of chorioallantoic fusion or cardiac abnormalities, including hemorrhage around the heart and defects in epicardium formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,908,717 S53G possibly damaging Het
Adgrb1 T A 15: 74,550,039 L886Q probably damaging Het
Adprhl1 G A 8: 13,248,624 T102M probably damaging Het
Akap6 A C 12: 52,887,029 K435Q probably damaging Het
Aldh7a1 T C 18: 56,546,950 probably null Het
Amfr T C 8: 93,974,804 R507G probably benign Het
Ap1m1 T A 8: 72,251,875 probably null Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Ccar1 C A 10: 62,783,882 probably null Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col5a3 A G 9: 20,808,418 F215S unknown Het
Decr1 T C 4: 15,919,207 N312S possibly damaging Het
Diaph3 A T 14: 87,007,399 W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 probably benign Het
Ehd3 C A 17: 73,828,186 D352E probably damaging Het
Enpp6 T G 8: 47,065,500 I221S probably benign Het
Fam186a T C 15: 99,939,789 probably benign Het
Gm5435 G T 12: 82,495,784 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr22 A C 12: 31,709,514 I203S probably benign Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Gstcd T C 3: 133,005,628 N431D probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hist1h1b T C 13: 21,779,999 S186G probably benign Het
Ift140 G T 17: 25,088,933 probably null Het
Ikbke A G 1: 131,270,226 V381A probably benign Het
Ing1 A C 8: 11,561,501 I38L probably benign Het
Ing1 T A 8: 11,561,502 I38N probably damaging Het
Kcnk12 C T 17: 87,746,373 G287D probably damaging Het
Kmt2e A C 5: 23,502,404 H1655P probably damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nav3 T A 10: 109,692,102 D2240V probably damaging Het
Ndufaf3 T C 9: 108,566,693 T9A probably damaging Het
Numb C A 12: 83,796,161 probably benign Het
Prodh2 T C 7: 30,494,089 V79A probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rnf19a G T 15: 36,244,101 Y604* probably null Het
Ros1 T A 10: 52,087,932 E1744V possibly damaging Het
Rpusd2 T C 2: 119,036,927 F219L probably benign Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Serpina3b T C 12: 104,130,879 F140L probably damaging Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Thumpd2 A G 17: 81,055,888 V50A probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Ttn C A 2: 76,743,245 R17441L probably damaging Het
Usp34 A G 11: 23,384,477 Y1157C probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r6 A G 3: 64,538,273 F677S probably damaging Het
Vmn2r84 C T 10: 130,389,139 A501T probably benign Het
Wapl C T 14: 34,724,769 P605S probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zfyve26 A G 12: 79,274,920 L975P probably damaging Het
Zp3r C T 1: 130,591,444 G255D probably damaging Het
Other mutations in Itga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Itga4 APN 2 79292050 missense probably benign 0.01
IGL01317:Itga4 APN 2 79322661 nonsense probably null
IGL01545:Itga4 APN 2 79315970 splice site probably benign
IGL01570:Itga4 APN 2 79322634 critical splice acceptor site probably null
IGL01575:Itga4 APN 2 79288255 missense probably damaging 1.00
IGL01837:Itga4 APN 2 79315005 missense probably damaging 1.00
IGL01974:Itga4 APN 2 79273127 splice site probably benign
IGL02087:Itga4 APN 2 79292069 missense probably damaging 0.99
IGL02245:Itga4 APN 2 79320559 missense probably benign 0.01
IGL02492:Itga4 APN 2 79255657 utr 5 prime probably benign
IGL02809:Itga4 APN 2 79280577 missense probably damaging 1.00
IGL02998:Itga4 APN 2 79277821 missense possibly damaging 0.88
IGL03008:Itga4 APN 2 79325638 missense probably benign
IGL03282:Itga4 APN 2 79325594 missense probably damaging 0.98
IGL03285:Itga4 APN 2 79279166 missense possibly damaging 0.48
IGL03286:Itga4 APN 2 79289362 missense probably damaging 1.00
R0001:Itga4 UTSW 2 79326587 missense probably damaging 0.99
R0045:Itga4 UTSW 2 79301031 missense probably damaging 1.00
R0276:Itga4 UTSW 2 79321493 missense probably damaging 0.99
R0554:Itga4 UTSW 2 79279117 missense probably damaging 1.00
R0556:Itga4 UTSW 2 79325639 missense probably benign
R0785:Itga4 UTSW 2 79289305 missense possibly damaging 0.89
R0787:Itga4 UTSW 2 79279153 missense probably benign 0.01
R1013:Itga4 UTSW 2 79320503 missense probably benign 0.00
R1237:Itga4 UTSW 2 79279146 missense probably null 0.08
R1471:Itga4 UTSW 2 79287032 missense probably benign 0.26
R1559:Itga4 UTSW 2 79315688 missense probably benign 0.04
R1769:Itga4 UTSW 2 79315706 critical splice donor site probably null
R1931:Itga4 UTSW 2 79313844 critical splice donor site probably null
R2012:Itga4 UTSW 2 79277794 missense probably damaging 1.00
R2241:Itga4 UTSW 2 79301013 missense probably damaging 1.00
R3793:Itga4 UTSW 2 79279128 missense probably benign 0.01
R4133:Itga4 UTSW 2 79322652 missense probably damaging 1.00
R4204:Itga4 UTSW 2 79279161 missense probably damaging 0.97
R4296:Itga4 UTSW 2 79272799 missense probably damaging 1.00
R4777:Itga4 UTSW 2 79313710 missense possibly damaging 0.87
R4906:Itga4 UTSW 2 79288248 missense probably damaging 1.00
R5048:Itga4 UTSW 2 79273034 missense probably benign 0.04
R5087:Itga4 UTSW 2 79315629 missense possibly damaging 0.95
R5212:Itga4 UTSW 2 79280595 missense probably damaging 1.00
R5213:Itga4 UTSW 2 79320576 missense probably benign 0.29
R5421:Itga4 UTSW 2 79316041 nonsense probably null
R5549:Itga4 UTSW 2 79256267 missense probably damaging 0.98
R5907:Itga4 UTSW 2 79322656 missense probably benign
R5917:Itga4 UTSW 2 79287098 missense probably damaging 1.00
R6309:Itga4 UTSW 2 79279085 missense probably damaging 1.00
R6764:Itga4 UTSW 2 79325614 missense probably benign 0.02
R6787:Itga4 UTSW 2 79289265 missense probably damaging 0.97
R6790:Itga4 UTSW 2 79325614 missense probably benign 0.02
R7051:Itga4 UTSW 2 79318126 missense possibly damaging 0.91
R7311:Itga4 UTSW 2 79256182 missense probably benign
R7520:Itga4 UTSW 2 79300989 missense probably damaging 1.00
R7573:Itga4 UTSW 2 79272993 missense probably benign
R7636:Itga4 UTSW 2 79313832 missense probably benign 0.01
R7889:Itga4 UTSW 2 79316045 missense probably benign 0.05
R8123:Itga4 UTSW 2 79315683 missense probably benign
R8284:Itga4 UTSW 2 79321439 missense probably benign 0.00
R8445:Itga4 UTSW 2 79281781 missense probably benign
R8553:Itga4 UTSW 2 79301061
Predicted Primers PCR Primer
(F):5'- GCGTGGCAATCATTCTATCCACTGAAC -3'
(R):5'- CCTGGTGACTTAAGATGATGTGAGCTG -3'

Sequencing Primer
(F):5'- ACTGAACCATCTTCTCCAGC -3'
(R):5'- CCATTTCCAAGATGGATGGC -3'
Posted On2014-02-18