Mutagenetix > Incidental Mutations

Incidental Mutation 'R5598:Cecr2'

437919

Institutional Source

Beutler Lab

Gene Symbol

Cecr2

Ensembl Gene

ENSMUSG00000071226

Gene Name

CECR2, histone acetyl-lysine reader

Synonyms

Gtl4, 2610101O16Rik, 2810409N01Rik

MMRRC Submission

043150-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5598 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120666369-120771190 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to G at 120731446 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108306 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686] [ENSMUST00000129803]

Predicted Effect

probably null
Transcript: ENSMUST00000100993

SMART Domains

Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
Pfam:WHIM3	244	284	5.2e-11	PFAM
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	781	796	N/A	INTRINSIC
low complexity region	839	855	N/A	INTRINSIC
low complexity region	890	907	N/A	INTRINSIC
low complexity region	1173	1187	N/A	INTRINSIC
low complexity region	1202	1223	N/A	INTRINSIC
low complexity region	1355	1366	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000112686

SMART Domains

Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	753	768	N/A	INTRINSIC
low complexity region	811	827	N/A	INTRINSIC
low complexity region	862	879	N/A	INTRINSIC
low complexity region	1145	1159	N/A	INTRINSIC
low complexity region	1174	1195	N/A	INTRINSIC
low complexity region	1327	1338	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124634

Predicted Effect

probably benign
Transcript: ENSMUST00000129803

SMART Domains

Protein: ENSMUSP00000118542
Gene: ENSMUSG00000071226

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
coiled coil region	90	150	N/A	INTRINSIC
Pfam:Bromodomain	191	234	1.1e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204732

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adnp	T	C	2: 168,183,725	D550G	probably damaging	Het
Ano6	A	G	15: 95,941,347	T457A	probably damaging	Het
Ano8	A	G	8: 71,482,577	V359A	probably damaging	Het
Aqp2	G	T	15: 99,579,112		probably benign	Het
Atp13a5	C	T	16: 29,257,077		probably benign	Het
Carmil3	ACCCCC	ACCCCCCCCCCCC	14: 55,503,999		probably null	Het
Ccr1l1	A	G	9: 123,977,993	V139A	probably benign	Het
Celsr2	A	G	3: 108,402,803	V1537A	possibly damaging	Het
Chd6	T	A	2: 161,014,112	K741N	probably damaging	Het
Chrna1	T	A	2: 73,566,731	T405S	probably benign	Het
Cish	T	C	9: 107,297,028	V5A	possibly damaging	Het
Cmss1	C	A	16: 57,311,286	C159F	probably damaging	Het
Col1a2	A	G	6: 4,516,916		probably benign	Het
Cradd	G	T	10: 95,175,804	S158*	probably null	Het
Dmxl1	G	A	18: 49,864,478	A578T	probably benign	Het
Drd2	A	G	9: 49,407,015	N419S	possibly damaging	Het
E4f1	T	C	17: 24,447,129	T232A	probably damaging	Het
Fat2	T	A	11: 55,281,130	E2919V	probably damaging	Het
Gc	T	C	5: 89,438,450		probably null	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hsd11b2	G	A	8: 105,522,511	V173I	probably benign	Het
Kdm6b	C	T	11: 69,406,074	A456T	probably damaging	Het
Kif18b	G	A	11: 102,908,189	P729S	possibly damaging	Het
Lgi1	A	G	19: 38,306,181	D467G	possibly damaging	Het
Loxl1	A	G	9: 58,312,367	Y174H	possibly damaging	Het
Mtus1	A	T	8: 41,022,555	I824N	probably damaging	Het
Myrf	C	T	19: 10,215,290	E622K	probably benign	Het
Ncam1	A	G	9: 49,545,751	Y416H	probably damaging	Het
Nceh1	A	G	3: 27,226,099	T132A	probably benign	Het
Nhlrc4	G	A	17: 25,943,492	P94S	probably damaging	Het
Olfr56	C	G	11: 49,135,114	D307E	probably benign	Het
Olfr591	A	T	7: 103,173,634	M1K	probably null	Het
Olfr906	A	T	9: 38,488,525	R165S	possibly damaging	Het
Pcdhac2	A	G	18: 37,144,423	Y152C	probably damaging	Het
Pdia3	C	A	2: 121,414,130	T8K	possibly damaging	Het
Pogz	T	A	3: 94,864,509	V304E	probably damaging	Het
Snrnp200	A	G	2: 127,226,087	S835G	possibly damaging	Het
Susd4	T	C	1: 182,892,070	S417P	probably benign	Het
Thsd7b	G	A	1: 129,595,841	R127H	probably damaging	Het
Tmco4	A	G	4: 139,053,905	D460G	probably damaging	Het
Ttll9	T	A	2: 152,984,314	M148K	probably damaging	Het
Ubn2	G	A	6: 38,490,388	C677Y	probably benign	Het
Vmn2r98	T	C	17: 19,080,899	I721T	probably benign	Het
Wdfy4	C	A	14: 33,133,497	C720F	probably damaging	Het
Zzef1	G	A	11: 72,916,521	D2742N	probably damaging	Het

Other mutations in Cecr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Cecr2	APN	6	120756717	missense	probably damaging	1.00
IGL00782:Cecr2	APN	6	120761621	missense	probably benign	0.00
IGL01137:Cecr2	APN	6	120762028	missense	probably damaging	1.00
IGL01446:Cecr2	APN	6	120758599	missense	probably benign
IGL02108:Cecr2	APN	6	120762558	critical splice donor site	probably null
IGL02195:Cecr2	APN	6	120731406	missense	probably damaging	1.00
IGL02689:Cecr2	APN	6	120762167	missense	probably damaging	1.00
IGL03189:Cecr2	APN	6	120762430	missense	probably benign	0.13
PIT1430001:Cecr2	UTSW	6	120758479	missense	probably benign	0.01
R0200:Cecr2	UTSW	6	120761797	missense	probably damaging	1.00
R0586:Cecr2	UTSW	6	120757884	missense	probably damaging	1.00
R0715:Cecr2	UTSW	6	120758198	missense	probably benign	0.21
R0784:Cecr2	UTSW	6	120758149	missense	possibly damaging	0.74
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1343:Cecr2	UTSW	6	120754711	missense	probably damaging	0.99
R1349:Cecr2	UTSW	6	120757603	missense	probably damaging	0.99
R1386:Cecr2	UTSW	6	120762131	missense	probably damaging	1.00
R1438:Cecr2	UTSW	6	120761472	nonsense	probably null
R1602:Cecr2	UTSW	6	120755587	missense	possibly damaging	0.52
R1664:Cecr2	UTSW	6	120762026	missense	probably damaging	0.96
R1731:Cecr2	UTSW	6	120758180	missense	possibly damaging	0.74
R1817:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1818:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1819:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1862:Cecr2	UTSW	6	120757941	missense	probably damaging	1.00
R1907:Cecr2	UTSW	6	120761160	missense	probably benign	0.03
R1911:Cecr2	UTSW	6	120762565	unclassified	probably benign
R2135:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00
R2273:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R2275:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R3713:Cecr2	UTSW	6	120758260	missense	probably damaging	1.00
R4271:Cecr2	UTSW	6	120762475	missense	probably damaging	1.00
R4706:Cecr2	UTSW	6	120755578	missense	possibly damaging	0.73
R4873:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R4875:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R5137:Cecr2	UTSW	6	120755517	missense	probably benign
R5153:Cecr2	UTSW	6	120734560	missense	probably benign	0.03
R5377:Cecr2	UTSW	6	120756569	missense	possibly damaging	0.87
R5651:Cecr2	UTSW	6	120755560	missense	probably damaging	0.96
R5680:Cecr2	UTSW	6	120761426	missense	probably benign
R5813:Cecr2	UTSW	6	120762208	missense	probably damaging	0.99
R5970:Cecr2	UTSW	6	120720907	missense	probably damaging	0.98
R6255:Cecr2	UTSW	6	120758050	missense	probably damaging	1.00
R6266:Cecr2	UTSW	6	120761686	missense	probably benign
R6630:Cecr2	UTSW	6	120762178	missense	probably damaging	1.00
R6737:Cecr2	UTSW	6	120737123	missense	possibly damaging	0.86
R6754:Cecr2	UTSW	6	120757578	missense	probably damaging	0.98
R6807:Cecr2	UTSW	6	120734542	splice site	probably null
R7187:Cecr2	UTSW	6	120756686	missense	probably benign
R7256:Cecr2	UTSW	6	120762529	missense	probably benign
R7282:Cecr2	UTSW	6	120761621	missense
R7548:Cecr2	UTSW	6	120761714	missense
R7596:Cecr2	UTSW	6	120762206	missense	probably benign
R7802:Cecr2	UTSW	6	120743847	missense	probably benign	0.45
R8112:Cecr2	UTSW	6	120762214	missense	probably benign	0.00
R8289:Cecr2	UTSW	6	120758116	missense	probably benign	0.24
R8294:Cecr2	UTSW	6	120733786	missense	probably damaging	0.99
R8470:Cecr2	UTSW	6	120756933	missense	probably benign	0.21
X0012:Cecr2	UTSW	6	120733774	missense	probably damaging	0.99
X0063:Cecr2	UTSW	6	120762071	missense	probably benign	0.01
Z1177:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCACAGCTACTTGGAAGATATC -3'
(R):5'- CCTATTTGAACCATGGCTCAGG -3'

Sequencing Primer
(F):5'- TCATTAACTACCGTTGGGAGC -3'
(R):5'- TTTTAAAGCCATATCCCAGCATGGC -3'

Posted On

2016-10-26