Incidental Mutation 'R1632:Dhrs3'
ID172838
Institutional Source Beutler Lab
Gene Symbol Dhrs3
Ensembl Gene ENSMUSG00000066026
Gene Namedehydrogenase/reductase (SDR family) member 3
SynonymsRsdr1, retSDR1
MMRRC Submission 039669-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1632 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location144892827-144928209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144893546 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 11 (V11A)
Ref Sequence ENSEMBL: ENSMUSP00000081200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084184] [ENSMUST00000105744] [ENSMUST00000142808] [ENSMUST00000154208] [ENSMUST00000171001]
Predicted Effect probably benign
Transcript: ENSMUST00000084184
AA Change: V11A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081200
Gene: ENSMUSG00000066026
AA Change: V11A

DomainStartEndE-ValueType
Pfam:adh_short 39 121 1.7e-19 PFAM
Pfam:KR 40 119 1.5e-16 PFAM
Pfam:Polysacc_synt_2 41 121 1.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105744
SMART Domains Protein: ENSMUSP00000101370
Gene: ENSMUSG00000066026

DomainStartEndE-ValueType
Pfam:adh_short 13 92 2.1e-18 PFAM
Pfam:KR 14 93 1.5e-15 PFAM
Pfam:Polysacc_synt_2 15 90 4.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128926
Predicted Effect probably benign
Transcript: ENSMUST00000142808
SMART Domains Protein: ENSMUSP00000122578
Gene: ENSMUSG00000066026

DomainStartEndE-ValueType
Pfam:adh_short 13 146 6.1e-29 PFAM
Pfam:KR 14 139 5.9e-20 PFAM
Pfam:Polysacc_synt_2 15 109 4.2e-10 PFAM
Pfam:Epimerase 15 124 3.8e-8 PFAM
Pfam:adh_short_C2 19 146 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154208
AA Change: V11A

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122552
Gene: ENSMUSG00000066026
AA Change: V11A

DomainStartEndE-ValueType
Pfam:adh_short 39 233 7.8e-42 PFAM
Pfam:KR 40 213 2.3e-21 PFAM
Pfam:Polysacc_synt_2 41 132 2.8e-9 PFAM
Pfam:adh_short_C2 45 205 4.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171001
SMART Domains Protein: ENSMUSP00000126154
Gene: ENSMUSG00000066026

DomainStartEndE-ValueType
Pfam:adh_short 13 181 2.1e-34 PFAM
Pfam:KR 14 191 2.7e-21 PFAM
Pfam:Polysacc_synt_2 15 106 1.8e-9 PFAM
Pfam:Epimerase 15 124 2e-7 PFAM
Pfam:adh_short_C2 19 179 2e-14 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Short-chain dehydrogenases/reductases (SDRs), such as DHRS3, catalyze the oxidation/reduction of a wide range of substrates, including retinoids and steroids (Haeseleer and Palczewski, 2000 [PubMed 10800688]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a targeted mutation die before weaning age. Mice homozygous for a gene trap allele exhibit perinatal lethality, altered retinoid metabolism and heart, craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,290,402 D118G probably damaging Het
AF529169 T A 9: 89,602,360 H328L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 A T 17: 67,849,074 Y696N probably damaging Het
C77080 A G 4: 129,222,666 M735T possibly damaging Het
Cachd1 A G 4: 100,966,972 T537A probably benign Het
Capn15 A T 17: 25,960,665 F841Y probably damaging Het
Card10 G A 15: 78,791,220 R396* probably null Het
Chd9 A T 8: 90,956,707 K592* probably null Het
Cyp2j8 T A 4: 96,447,324 H411L probably benign Het
Dhcr24 G T 4: 106,585,951 M394I probably benign Het
Dync1li2 A T 8: 104,437,491 I134N probably damaging Het
Enpp4 G T 17: 44,099,653 S344Y probably damaging Het
Ephb3 T C 16: 21,212,937 S14P probably benign Het
Fancm T G 12: 65,130,331 I1983S probably damaging Het
Fndc1 T C 17: 7,773,200 T555A unknown Het
Gemin4 A T 11: 76,210,989 M982K probably benign Het
Gtpbp2 A G 17: 46,168,592 R590G probably benign Het
H2-M3 G A 17: 37,271,163 R170H probably benign Het
Hoxa13 G T 6: 52,259,937 N278K probably damaging Het
Hspb3 A G 13: 113,663,053 V147A probably benign Het
Il6st G T 13: 112,504,332 D820Y possibly damaging Het
Kdm7a A G 6: 39,152,898 V448A probably benign Het
Kmt2b T C 7: 30,583,962 D991G probably damaging Het
Kri1 T C 9: 21,282,211 D140G possibly damaging Het
Limk2 A G 11: 3,346,250 L399P probably damaging Het
Lrrc9 T A 12: 72,460,020 probably null Het
Map2 C T 1: 66,415,086 T1045M possibly damaging Het
Map4k5 T C 12: 69,828,047 I321V probably benign Het
Mpp5 T A 12: 78,797,038 Y5* probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh7b A G 2: 155,620,525 S383G probably benign Het
Nostrin A G 2: 69,175,734 K254R probably benign Het
Nphp1 G T 2: 127,770,392 P212T probably benign Het
Olfr988 A T 2: 85,353,242 M228K possibly damaging Het
Pclo A C 5: 14,680,003 probably benign Het
Phf19 G A 2: 34,911,619 R60W probably damaging Het
Psg18 G A 7: 18,350,899 P91S probably benign Het
Rttn C T 18: 89,009,336 T525I probably benign Het
Ryr1 T C 7: 29,094,261 M1268V probably benign Het
Slc25a2 T C 18: 37,637,687 E263G possibly damaging Het
Slc32a1 C T 2: 158,613,890 A155V possibly damaging Het
Slc6a19 A T 13: 73,689,908 probably null Het
Socs4 A G 14: 47,289,577 probably benign Het
Tas2r118 A G 6: 23,969,261 I267T probably benign Het
Tpte G A 8: 22,349,347 C470Y probably damaging Het
Usp17la A T 7: 104,860,911 H241L probably benign Het
Vmn2r72 T A 7: 85,751,792 I140F probably benign Het
Zfp329 T C 7: 12,810,949 D216G possibly damaging Het
Other mutations in Dhrs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01730:Dhrs3 APN 4 144919472 missense probably damaging 0.96
IGL02226:Dhrs3 APN 4 144923949 missense possibly damaging 0.94
IGL02236:Dhrs3 APN 4 144893563 missense probably benign
IGL02728:Dhrs3 APN 4 144920072 missense probably damaging 0.98
R0079:Dhrs3 UTSW 4 144920048 missense probably damaging 0.99
R0734:Dhrs3 UTSW 4 144927176 missense probably damaging 0.99
R1474:Dhrs3 UTSW 4 144919487 missense probably damaging 1.00
R2010:Dhrs3 UTSW 4 144927188 missense possibly damaging 0.49
R3162:Dhrs3 UTSW 4 144919446 missense possibly damaging 0.80
R3162:Dhrs3 UTSW 4 144919446 missense possibly damaging 0.80
R3176:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R3276:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R3440:Dhrs3 UTSW 4 144920058 missense probably damaging 1.00
R3709:Dhrs3 UTSW 4 144893711 critical splice donor site probably null
R3795:Dhrs3 UTSW 4 144919392 missense probably damaging 0.99
R5571:Dhrs3 UTSW 4 144893564 missense probably benign 0.34
R5943:Dhrs3 UTSW 4 144919976 missense possibly damaging 0.88
R6457:Dhrs3 UTSW 4 144919952 missense probably damaging 1.00
R7607:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGTTCAAGAGTGACCAGGTGGG -3'
(R):5'- CACCTTAGAGAAAGAGTCATGCGGC -3'

Sequencing Primer
(F):5'- GGTGGGACGCCTCCTTTTC -3'
(R):5'- GGATGAAACCGACTTGCTTC -3'
Posted On2014-04-24