Incidental Mutation 'R3162:Dhrs3'
ID349836
Institutional Source Beutler Lab
Gene Symbol Dhrs3
Ensembl Gene ENSMUSG00000066026
Gene Namedehydrogenase/reductase (SDR family) member 3
SynonymsRsdr1, retSDR1
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3162 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location144892827-144928209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144919446 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 108 (D108G)
Ref Sequence ENSEMBL: ENSMUSP00000126154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084184] [ENSMUST00000105744] [ENSMUST00000142808] [ENSMUST00000154208] [ENSMUST00000171001]
Predicted Effect probably benign
Transcript: ENSMUST00000084184
SMART Domains Protein: ENSMUSP00000081200
Gene: ENSMUSG00000066026

DomainStartEndE-ValueType
Pfam:adh_short 39 121 1.7e-19 PFAM
Pfam:KR 40 119 1.5e-16 PFAM
Pfam:Polysacc_synt_2 41 121 1.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105744
SMART Domains Protein: ENSMUSP00000101370
Gene: ENSMUSG00000066026

DomainStartEndE-ValueType
Pfam:adh_short 13 92 2.1e-18 PFAM
Pfam:KR 14 93 1.5e-15 PFAM
Pfam:Polysacc_synt_2 15 90 4.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133265
Predicted Effect possibly damaging
Transcript: ENSMUST00000142808
AA Change: D108G

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122578
Gene: ENSMUSG00000066026
AA Change: D108G

DomainStartEndE-ValueType
Pfam:adh_short 13 146 6.1e-29 PFAM
Pfam:KR 14 139 5.9e-20 PFAM
Pfam:Polysacc_synt_2 15 109 4.2e-10 PFAM
Pfam:Epimerase 15 124 3.8e-8 PFAM
Pfam:adh_short_C2 19 146 3.3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000154208
AA Change: D134G

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122552
Gene: ENSMUSG00000066026
AA Change: D134G

DomainStartEndE-ValueType
Pfam:adh_short 39 233 7.8e-42 PFAM
Pfam:KR 40 213 2.3e-21 PFAM
Pfam:Polysacc_synt_2 41 132 2.8e-9 PFAM
Pfam:adh_short_C2 45 205 4.8e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171001
AA Change: D108G

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126154
Gene: ENSMUSG00000066026
AA Change: D108G

DomainStartEndE-ValueType
Pfam:adh_short 13 181 2.1e-34 PFAM
Pfam:KR 14 191 2.7e-21 PFAM
Pfam:Polysacc_synt_2 15 106 1.8e-9 PFAM
Pfam:Epimerase 15 124 2e-7 PFAM
Pfam:adh_short_C2 19 179 2e-14 PFAM
Meta Mutation Damage Score 0.1729 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Short-chain dehydrogenases/reductases (SDRs), such as DHRS3, catalyze the oxidation/reduction of a wide range of substrates, including retinoids and steroids (Haeseleer and Palczewski, 2000 [PubMed 10800688]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a targeted mutation die before weaning age. Mice homozygous for a gene trap allele exhibit perinatal lethality, altered retinoid metabolism and heart, craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
9930014A18Rik A T 15: 60,823,447 V150E probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Gm13141 GGTTTCTTGATGCC G 4: 147,528,104 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hpx C T 7: 105,599,640 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Wdr61 T A 9: 54,724,189 probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Dhrs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01730:Dhrs3 APN 4 144919472 missense probably damaging 0.96
IGL02226:Dhrs3 APN 4 144923949 missense possibly damaging 0.94
IGL02236:Dhrs3 APN 4 144893563 missense probably benign
IGL02728:Dhrs3 APN 4 144920072 missense probably damaging 0.98
R0079:Dhrs3 UTSW 4 144920048 missense probably damaging 0.99
R0734:Dhrs3 UTSW 4 144927176 missense probably damaging 0.99
R1474:Dhrs3 UTSW 4 144919487 missense probably damaging 1.00
R1632:Dhrs3 UTSW 4 144893546 missense probably benign 0.30
R2010:Dhrs3 UTSW 4 144927188 missense possibly damaging 0.49
R3162:Dhrs3 UTSW 4 144919446 missense possibly damaging 0.80
R3176:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R3276:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R3440:Dhrs3 UTSW 4 144920058 missense probably damaging 1.00
R3709:Dhrs3 UTSW 4 144893711 critical splice donor site probably null
R3795:Dhrs3 UTSW 4 144919392 missense probably damaging 0.99
R5571:Dhrs3 UTSW 4 144893564 missense probably benign 0.34
R5943:Dhrs3 UTSW 4 144919976 missense possibly damaging 0.88
R6457:Dhrs3 UTSW 4 144919952 missense probably damaging 1.00
R7607:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R8144:Dhrs3 UTSW 4 144919904 missense probably damaging 1.00
R8371:Dhrs3 UTSW 4 144919383 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTAATCCTCAGACACAGCTGG -3'
(R):5'- TGTTGAATGTCCCTGCAGGC -3'

Sequencing Primer
(F):5'- TAATCCTCAGACACAGCTGGTATGG -3'
(R):5'- TGAATGTCCCTGCAGGCATGAG -3'
Posted On2015-10-08