Incidental Mutation 'R1616:Arid1b'
ID174307
Institutional Source Beutler Lab
Gene Symbol Arid1b
Ensembl Gene ENSMUSG00000069729
Gene NameAT rich interactive domain 1B (SWI-like)
SynonymsB230217J03Rik, 9330189K18Rik
MMRRC Submission 039653-MU
Accession Numbers

Ncbi RefSeq: NM_001085355.1; MGI:1926129

Is this an essential gene? Possibly essential (E-score: 0.644) question?
Stock #R1616 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location4994332-5347656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5339294 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1705 (I1705N)
Ref Sequence ENSEMBL: ENSMUSP00000156119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]
Predicted Effect probably damaging
Transcript: ENSMUST00000092723
AA Change: I1652N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729
AA Change: I1652N

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115797
AA Change: I1653N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729
AA Change: I1653N

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115799
AA Change: I1171N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729
AA Change: I1171N

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000232180
AA Change: I1705N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.3%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik T C 10: 20,311,341 probably benign Het
A1cf A G 19: 31,934,775 E430G probably damaging Het
Aacs T A 5: 125,484,526 probably null Het
Acot12 G A 13: 91,772,767 V331I probably benign Het
Acp7 A G 7: 28,611,078 W445R probably damaging Het
Actl11 C A 9: 107,931,936 Q1153K probably benign Het
Actr8 A G 14: 29,982,644 T34A possibly damaging Het
Ahnak A G 19: 9,008,987 D2545G possibly damaging Het
Ap5z1 A G 5: 142,472,236 Y388C probably benign Het
Apol7a C T 15: 77,389,606 G219S probably damaging Het
Bod1l T C 5: 41,808,715 Q2669R probably benign Het
Braf A T 6: 39,643,133 S504T probably benign Het
Cbl A T 9: 44,152,900 Y780N probably damaging Het
Cd86 T C 16: 36,628,976 I20V probably benign Het
Cep290 T G 10: 100,568,836 D2353E probably benign Het
Ckmt2 G A 13: 91,859,209 R289C probably benign Het
Col3a1 T C 1: 45,328,488 probably null Het
Cyp4f16 T A 17: 32,542,968 Y163* probably null Het
Dimt1 T C 13: 106,953,450 V227A possibly damaging Het
Dnah6 A T 6: 73,100,112 M2338K probably benign Het
Dock4 T G 12: 40,669,045 I274S probably damaging Het
Enthd1 T C 15: 80,452,385 D616G probably damaging Het
Fignl2 T C 15: 101,054,116 E95G probably damaging Het
Foxn1 A G 11: 78,358,866 M611T probably benign Het
Foxs1 T C 2: 152,932,639 S165G probably benign Het
Fzd3 G T 14: 65,235,507 Q271K probably benign Het
Hadhb A T 5: 30,166,715 I55F probably damaging Het
Hipk3 G A 2: 104,433,745 Q824* probably null Het
Hps1 G A 19: 42,767,185 R201W probably damaging Het
Kif21b T C 1: 136,171,685 S1477P probably damaging Het
Kif26a A T 12: 112,157,246 probably null Het
Krt90 T C 15: 101,560,591 E172G possibly damaging Het
Lama4 T G 10: 39,075,450 F1064V probably damaging Het
Leng9 A G 7: 4,148,903 V258A probably benign Het
Lgi2 A C 5: 52,546,638 V217G probably benign Het
Lpgat1 T C 1: 191,763,629 I310T possibly damaging Het
Ltbp3 A G 19: 5,746,967 Y374C probably damaging Het
Magi2 C A 5: 20,609,326 T1075K probably damaging Het
Man2c1 T C 9: 57,135,509 I221T probably benign Het
Mydgf A G 17: 56,179,415 M72T possibly damaging Het
Myo1b T C 1: 51,776,315 N624S probably damaging Het
Myo5c T A 9: 75,296,017 M1465K probably damaging Het
Nek4 A T 14: 30,987,137 D716V probably damaging Het
Nfxl1 T A 5: 72,529,037 Q607L probably benign Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nop14 G T 5: 34,650,413 Q402K possibly damaging Het
Npy5r C G 8: 66,681,400 C247S probably damaging Het
Nrap T A 19: 56,389,823 I19F probably damaging Het
Olfr1189 A G 2: 88,592,008 D68G probably damaging Het
Olfr1336 T G 7: 6,460,745 S79A probably damaging Het
Olfr574 T A 7: 102,948,514 N16K probably damaging Het
Pcdh9 A T 14: 93,886,969 Y588* probably null Het
Ppp1r12a A G 10: 108,260,867 E183G probably damaging Het
Ppp2r2b T A 18: 42,688,310 H261L probably benign Het
Ptch1 G T 13: 63,539,842 T374K possibly damaging Het
Ptpn13 A T 5: 103,565,237 N1742I possibly damaging Het
Rab33a C T X: 48,519,644 S15L probably benign Het
Ralb T C 1: 119,478,014 Y75C probably damaging Het
Rassf7 T A 7: 141,216,732 V2D probably damaging Het
Rbm10 A G X: 20,645,991 N397S probably benign Het
Rbm15 T C 3: 107,330,881 T734A probably benign Het
Rbm8a G T 3: 96,631,730 probably benign Het
Rock2 T C 12: 16,972,985 I1095T probably benign Het
Rxfp3 T A 15: 11,036,303 T328S probably damaging Het
Sec31a T A 5: 100,386,195 K505N possibly damaging Het
Selenof A G 3: 144,596,881 *122W probably null Het
Sh3pxd2b T C 11: 32,381,441 M55T possibly damaging Het
Slc15a2 T C 16: 36,754,481 D522G probably benign Het
Slc2a1 T C 4: 119,136,306 F447L probably damaging Het
Slc45a2 T A 15: 11,022,128 C319S probably null Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stab2 A T 10: 86,885,718 probably null Het
Tanc1 A G 2: 59,785,387 D246G probably damaging Het
Tekt3 T G 11: 63,087,198 probably null Het
Them5 G A 3: 94,346,260 probably null Het
Tlr4 T A 4: 66,839,480 F170Y probably damaging Het
Tmem214 T G 5: 30,871,563 Y165* probably null Het
Tmem94 T C 11: 115,796,145 probably null Het
Tom1l1 A G 11: 90,656,351 L301S possibly damaging Het
Trpm3 A G 19: 22,982,712 E1237G probably damaging Het
Ube2d1 C A 10: 71,256,693 C107F probably damaging Het
Ugt3a1 C T 15: 9,306,244 R160* probably null Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Virma T C 4: 11,544,954 F1638L probably damaging Het
Vmn1r31 G A 6: 58,472,058 T274I probably damaging Het
Xylt2 C T 11: 94,668,209 S445N probably damaging Het
Zfp457 A G 13: 67,296,311 F43L possibly damaging Het
Zfp879 T A 11: 50,832,646 M455L probably benign Het
Other mutations in Arid1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Arid1b APN 17 5337110 missense possibly damaging 0.77
IGL00340:Arid1b APN 17 5321284 missense probably damaging 1.00
IGL00886:Arid1b APN 17 5126979 missense probably damaging 0.99
IGL01161:Arid1b APN 17 5342399 missense probably damaging 1.00
IGL01391:Arid1b APN 17 5318858 splice site probably benign
IGL01456:Arid1b APN 17 5291235 missense probably damaging 1.00
IGL02152:Arid1b APN 17 5313968 missense probably damaging 1.00
IGL02288:Arid1b APN 17 5264040 missense possibly damaging 0.88
IGL02713:Arid1b APN 17 5343011 missense probably damaging 1.00
IGL02858:Arid1b APN 17 5341891 missense possibly damaging 0.92
IGL02885:Arid1b APN 17 5342153 missense probably damaging 1.00
IGL02989:Arid1b APN 17 5335047 missense probably damaging 1.00
FR4449:Arid1b UTSW 17 4995589 small insertion probably benign
PIT4142001:Arid1b UTSW 17 5339243 missense probably damaging 1.00
R0048:Arid1b UTSW 17 5314034 critical splice donor site probably null
R0124:Arid1b UTSW 17 5339330 missense probably damaging 1.00
R0153:Arid1b UTSW 17 5342932 missense probably damaging 1.00
R0465:Arid1b UTSW 17 4996260 missense possibly damaging 0.68
R0825:Arid1b UTSW 17 5342178 missense probably damaging 1.00
R1172:Arid1b UTSW 17 5339300 missense probably damaging 1.00
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1754:Arid1b UTSW 17 5279201 critical splice acceptor site probably null
R1760:Arid1b UTSW 17 5341813 missense probably damaging 0.97
R1812:Arid1b UTSW 17 5337029 missense probably benign 0.10
R1911:Arid1b UTSW 17 5342966 missense probably damaging 1.00
R3874:Arid1b UTSW 17 5336515 splice site probably null
R3913:Arid1b UTSW 17 5342257 missense possibly damaging 0.94
R3916:Arid1b UTSW 17 5342653 missense probably benign 0.25
R3922:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R4119:Arid1b UTSW 17 4995794 unclassified probably benign
R4290:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4291:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4352:Arid1b UTSW 17 5097584 missense possibly damaging 0.93
R4386:Arid1b UTSW 17 4994972 unclassified probably benign
R4458:Arid1b UTSW 17 5242916 missense probably damaging 0.99
R4524:Arid1b UTSW 17 5097620 missense possibly damaging 0.93
R4622:Arid1b UTSW 17 4995050 unclassified probably benign
R4723:Arid1b UTSW 17 5337290 missense probably benign 0.01
R4782:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4799:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4910:Arid1b UTSW 17 5342203 missense probably damaging 1.00
R4946:Arid1b UTSW 17 5342843 missense probably damaging 0.99
R5083:Arid1b UTSW 17 5314018 missense possibly damaging 0.54
R5204:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R5347:Arid1b UTSW 17 5291057 nonsense probably null
R5553:Arid1b UTSW 17 5313877 missense probably damaging 1.00
R5713:Arid1b UTSW 17 5336816 missense probably damaging 1.00
R5820:Arid1b UTSW 17 4996254 missense possibly damaging 0.96
R5992:Arid1b UTSW 17 4994956 unclassified probably benign
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6153:Arid1b UTSW 17 5242832 missense probably damaging 1.00
R6222:Arid1b UTSW 17 5327647 critical splice acceptor site probably null
R6249:Arid1b UTSW 17 5279361 missense possibly damaging 0.61
R6279:Arid1b UTSW 17 5341999 missense probably damaging 1.00
R6329:Arid1b UTSW 17 5337263 nonsense probably null
R6368:Arid1b UTSW 17 5332533 missense possibly damaging 0.64
R6466:Arid1b UTSW 17 5327678 missense probably damaging 1.00
R6861:Arid1b UTSW 17 5327686 missense possibly damaging 0.93
R7008:Arid1b UTSW 17 5290979 missense probably damaging 1.00
R7270:Arid1b UTSW 17 4996043 missense unknown
R7514:Arid1b UTSW 17 5341714 missense probably benign 0.28
R7519:Arid1b UTSW 17 4995844 small insertion probably benign
R7519:Arid1b UTSW 17 4995853 small insertion probably benign
R7521:Arid1b UTSW 17 4995844 small insertion probably benign
R7521:Arid1b UTSW 17 4995860 small insertion probably benign
R7521:Arid1b UTSW 17 5342590 missense probably benign 0.06
R7616:Arid1b UTSW 17 4995386 missense unknown
R7654:Arid1b UTSW 17 5291085 missense possibly damaging 0.46
R7711:Arid1b UTSW 17 5336820 missense probably benign 0.28
R7828:Arid1b UTSW 17 5097668 missense probably damaging 1.00
R7864:Arid1b UTSW 17 5342255 missense probably damaging 1.00
R7998:Arid1b UTSW 17 5327684 missense probably damaging 1.00
R8105:Arid1b UTSW 17 5291243 missense possibly damaging 0.81
R8260:Arid1b UTSW 17 5332513 missense probably benign 0.03
R8374:Arid1b UTSW 17 5342644 missense possibly damaging 0.95
RF007:Arid1b UTSW 17 4995594 small insertion probably benign
RF008:Arid1b UTSW 17 4995594 small insertion probably benign
RF008:Arid1b UTSW 17 4995595 small insertion probably benign
RF025:Arid1b UTSW 17 4995588 small insertion probably benign
RF025:Arid1b UTSW 17 4995596 small insertion probably benign
RF028:Arid1b UTSW 17 4995598 small insertion probably benign
RF032:Arid1b UTSW 17 4995588 small insertion probably benign
RF033:Arid1b UTSW 17 4995585 small insertion probably benign
RF041:Arid1b UTSW 17 4995595 small insertion probably benign
RF045:Arid1b UTSW 17 4995583 small insertion probably benign
RF046:Arid1b UTSW 17 4995590 small insertion probably benign
RF058:Arid1b UTSW 17 4995583 small insertion probably benign
X0023:Arid1b UTSW 17 5342393 missense probably benign 0.39
X0027:Arid1b UTSW 17 5342372 nonsense probably null
Z1177:Arid1b UTSW 17 4996328 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGCTAACGTCAGATGAAGCTGCAC -3'
(R):5'- TGGTTGAAGGCTGCACTACATGAG -3'

Sequencing Primer
(F):5'- TCCAGAGCCGAGGTTCATAA -3'
(R):5'- cacacacacacacacacacac -3'
Posted On2014-04-24