Incidental Mutation 'R1616:Ptch1'
ID 174287
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Name patched 1
Synonyms wig, Ptc, Ptc1, A230106A15Rik, Patched 1
MMRRC Submission 039653-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1616 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 63656142-63721274 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 63687656 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 374 (T374K)
Ref Sequence ENSEMBL: ENSMUSP00000141489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000193953] [ENSMUST00000194663] [ENSMUST00000195106] [ENSMUST00000195258] [ENSMUST00000195756]
AlphaFold Q61115
Predicted Effect possibly damaging
Transcript: ENSMUST00000021921
AA Change: T511K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: T511K

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192155
AA Change: T374K

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: T374K

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193953
Predicted Effect possibly damaging
Transcript: ENSMUST00000194663
AA Change: T459K

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466
AA Change: T459K

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195106
SMART Domains Protein: ENSMUSP00000141298
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
low complexity region 38 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195258
AA Change: T404K

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466
AA Change: T404K

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223515
Predicted Effect probably benign
Transcript: ENSMUST00000195756
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.3%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik T C 10: 20,187,087 (GRCm39) probably benign Het
A1cf A G 19: 31,912,175 (GRCm39) E430G probably damaging Het
Aacs T A 5: 125,561,590 (GRCm39) probably null Het
Acot12 G A 13: 91,920,886 (GRCm39) V331I probably benign Het
Acp7 A G 7: 28,310,503 (GRCm39) W445R probably damaging Het
Actl11 C A 9: 107,809,135 (GRCm39) Q1153K probably benign Het
Actr8 A G 14: 29,704,601 (GRCm39) T34A possibly damaging Het
Ahnak A G 19: 8,986,351 (GRCm39) D2545G possibly damaging Het
Ap5z1 A G 5: 142,457,991 (GRCm39) Y388C probably benign Het
Apol7a C T 15: 77,273,806 (GRCm39) G219S probably damaging Het
Arid1b T A 17: 5,389,569 (GRCm39) I1705N probably damaging Het
Bod1l T C 5: 41,966,058 (GRCm39) Q2669R probably benign Het
Braf A T 6: 39,620,067 (GRCm39) S504T probably benign Het
Cbl A T 9: 44,064,197 (GRCm39) Y780N probably damaging Het
Cd86 T C 16: 36,449,338 (GRCm39) I20V probably benign Het
Cep290 T G 10: 100,404,698 (GRCm39) D2353E probably benign Het
Ckmt2 G A 13: 92,007,328 (GRCm39) R289C probably benign Het
Col3a1 T C 1: 45,367,648 (GRCm39) probably null Het
Cyp4f16 T A 17: 32,761,942 (GRCm39) Y163* probably null Het
Dimt1 T C 13: 107,089,958 (GRCm39) V227A possibly damaging Het
Dnah6 A T 6: 73,077,095 (GRCm39) M2338K probably benign Het
Dock4 T G 12: 40,719,044 (GRCm39) I274S probably damaging Het
Enthd1 T C 15: 80,336,586 (GRCm39) D616G probably damaging Het
Fignl2 T C 15: 100,951,997 (GRCm39) E95G probably damaging Het
Foxn1 A G 11: 78,249,692 (GRCm39) M611T probably benign Het
Foxs1 T C 2: 152,774,559 (GRCm39) S165G probably benign Het
Fzd3 G T 14: 65,472,956 (GRCm39) Q271K probably benign Het
Hadhb A T 5: 30,371,713 (GRCm39) I55F probably damaging Het
Hipk3 G A 2: 104,264,090 (GRCm39) Q824* probably null Het
Hps1 G A 19: 42,755,624 (GRCm39) R201W probably damaging Het
Kif21b T C 1: 136,099,423 (GRCm39) S1477P probably damaging Het
Kif26a A T 12: 112,123,680 (GRCm39) probably null Het
Krt90 T C 15: 101,469,026 (GRCm39) E172G possibly damaging Het
Lama4 T G 10: 38,951,446 (GRCm39) F1064V probably damaging Het
Leng9 A G 7: 4,151,902 (GRCm39) V258A probably benign Het
Lgi2 A C 5: 52,703,980 (GRCm39) V217G probably benign Het
Lpgat1 T C 1: 191,495,741 (GRCm39) I310T possibly damaging Het
Ltbp3 A G 19: 5,796,995 (GRCm39) Y374C probably damaging Het
Magi2 C A 5: 20,814,324 (GRCm39) T1075K probably damaging Het
Man2c1 T C 9: 57,042,793 (GRCm39) I221T probably benign Het
Mydgf A G 17: 56,486,415 (GRCm39) M72T possibly damaging Het
Myo1b T C 1: 51,815,474 (GRCm39) N624S probably damaging Het
Myo5c T A 9: 75,203,299 (GRCm39) M1465K probably damaging Het
Nek4 A T 14: 30,709,094 (GRCm39) D716V probably damaging Het
Nfxl1 T A 5: 72,686,380 (GRCm39) Q607L probably benign Het
Nlrp9c A T 7: 26,083,862 (GRCm39) D572E probably benign Het
Nop14 G T 5: 34,807,757 (GRCm39) Q402K possibly damaging Het
Npy5r C G 8: 67,134,052 (GRCm39) C247S probably damaging Het
Nrap T A 19: 56,378,255 (GRCm39) I19F probably damaging Het
Or4c102 A G 2: 88,422,352 (GRCm39) D68G probably damaging Het
Or51t4 T A 7: 102,597,721 (GRCm39) N16K probably damaging Het
Or6z3 T G 7: 6,463,744 (GRCm39) S79A probably damaging Het
Pcdh9 A T 14: 94,124,405 (GRCm39) Y588* probably null Het
Ppp1r12a A G 10: 108,096,728 (GRCm39) E183G probably damaging Het
Ppp2r2b T A 18: 42,821,375 (GRCm39) H261L probably benign Het
Ptpn13 A T 5: 103,713,103 (GRCm39) N1742I possibly damaging Het
Rab33a C T X: 47,608,521 (GRCm39) S15L probably benign Het
Ralb T C 1: 119,405,744 (GRCm39) Y75C probably damaging Het
Rassf7 T A 7: 140,796,645 (GRCm39) V2D probably damaging Het
Rbm10 A G X: 20,512,230 (GRCm39) N397S probably benign Het
Rbm15 T C 3: 107,238,197 (GRCm39) T734A probably benign Het
Rbm8a G T 3: 96,539,046 (GRCm39) probably benign Het
Rock2 T C 12: 17,022,986 (GRCm39) I1095T probably benign Het
Rxfp3 T A 15: 11,036,389 (GRCm39) T328S probably damaging Het
Sec31a T A 5: 100,534,054 (GRCm39) K505N possibly damaging Het
Selenof A G 3: 144,302,642 (GRCm39) *122W probably null Het
Sh3pxd2b T C 11: 32,331,441 (GRCm39) M55T possibly damaging Het
Slc15a2 T C 16: 36,574,843 (GRCm39) D522G probably benign Het
Slc2a1 T C 4: 118,993,503 (GRCm39) F447L probably damaging Het
Slc45a2 T A 15: 11,022,214 (GRCm39) C319S probably null Het
Smad4 T C 18: 73,773,333 (GRCm39) D551G probably benign Het
Smarcc2 A G 10: 128,318,662 (GRCm39) Y648C probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Stab2 A T 10: 86,721,582 (GRCm39) probably null Het
Tanc1 A G 2: 59,615,731 (GRCm39) D246G probably damaging Het
Tekt3 T G 11: 62,978,024 (GRCm39) probably null Het
Them5 G A 3: 94,253,567 (GRCm39) probably null Het
Tlr4 T A 4: 66,757,717 (GRCm39) F170Y probably damaging Het
Tmem214 T G 5: 31,028,907 (GRCm39) Y165* probably null Het
Tmem94 T C 11: 115,686,971 (GRCm39) probably null Het
Tom1l1 A G 11: 90,547,177 (GRCm39) L301S possibly damaging Het
Trpm3 A G 19: 22,960,076 (GRCm39) E1237G probably damaging Het
Ube2d1 C A 10: 71,092,523 (GRCm39) C107F probably damaging Het
Ugt3a1 C T 15: 9,306,330 (GRCm39) R160* probably null Het
Vcan G A 13: 89,853,782 (GRCm39) P393S probably damaging Het
Virma T C 4: 11,544,954 (GRCm39) F1638L probably damaging Het
Vmn1r31 G A 6: 58,449,043 (GRCm39) T274I probably damaging Het
Xylt2 C T 11: 94,559,035 (GRCm39) S445N probably damaging Het
Zfp457 A G 13: 67,444,375 (GRCm39) F43L possibly damaging Het
Zfp879 T A 11: 50,723,473 (GRCm39) M455L probably benign Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63,674,989 (GRCm39) missense probably benign 0.00
IGL01084:Ptch1 APN 13 63,691,451 (GRCm39) missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63,659,495 (GRCm39) missense probably benign
IGL02260:Ptch1 APN 13 63,713,166 (GRCm39) unclassified probably benign
IGL02439:Ptch1 APN 13 63,692,910 (GRCm39) missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63,659,732 (GRCm39) missense probably benign 0.13
IGL02797:Ptch1 APN 13 63,681,421 (GRCm39) missense probably benign
R0463:Ptch1 UTSW 13 63,668,121 (GRCm39) missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63,691,294 (GRCm39) splice site probably benign
R0657:Ptch1 UTSW 13 63,661,565 (GRCm39) missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63,687,657 (GRCm39) missense probably benign 0.23
R1466:Ptch1 UTSW 13 63,672,783 (GRCm39) missense probably benign 0.02
R1466:Ptch1 UTSW 13 63,672,783 (GRCm39) missense probably benign 0.02
R1539:Ptch1 UTSW 13 63,689,101 (GRCm39) missense probably benign 0.00
R1883:Ptch1 UTSW 13 63,659,841 (GRCm39) nonsense probably null
R1985:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R1986:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2024:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2025:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2026:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2027:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2096:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2097:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2100:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2105:Ptch1 UTSW 13 63,693,059 (GRCm39) missense probably benign
R2165:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2166:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2167:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2168:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2226:Ptch1 UTSW 13 63,661,485 (GRCm39) missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2504:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2507:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2696:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2698:Ptch1 UTSW 13 63,690,038 (GRCm39) missense probably damaging 1.00
R2698:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2971:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3410:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3708:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3744:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3745:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3783:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3784:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3785:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3807:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3950:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4013:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4015:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4016:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4017:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4035:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4083:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4084:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4179:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63,691,422 (GRCm39) missense possibly damaging 0.68
R4625:Ptch1 UTSW 13 63,670,978 (GRCm39) missense probably benign 0.02
R4809:Ptch1 UTSW 13 63,661,522 (GRCm39) missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63,670,818 (GRCm39) missense probably damaging 1.00
R4911:Ptch1 UTSW 13 63,670,866 (GRCm39) missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63,672,884 (GRCm39) missense probably benign 0.02
R5386:Ptch1 UTSW 13 63,692,857 (GRCm39) missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63,675,059 (GRCm39) missense probably benign
R5604:Ptch1 UTSW 13 63,672,936 (GRCm39) missense probably benign 0.01
R5846:Ptch1 UTSW 13 63,713,268 (GRCm39) unclassified probably benign
R5926:Ptch1 UTSW 13 63,692,869 (GRCm39) missense probably benign 0.01
R5945:Ptch1 UTSW 13 63,721,233 (GRCm39) utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63,672,929 (GRCm39) missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63,691,359 (GRCm39) missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63,661,503 (GRCm39) missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63,691,422 (GRCm39) missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63,670,918 (GRCm39) missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63,687,644 (GRCm39) missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63,672,881 (GRCm39) missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63,659,550 (GRCm39) missense probably benign 0.23
R7168:Ptch1 UTSW 13 63,659,874 (GRCm39) missense probably benign
R7257:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7258:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7259:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7368:Ptch1 UTSW 13 63,659,798 (GRCm39) missense probably benign 0.06
R7525:Ptch1 UTSW 13 63,659,528 (GRCm39) missense probably benign 0.00
R7528:Ptch1 UTSW 13 63,659,528 (GRCm39) missense probably benign 0.00
R7820:Ptch1 UTSW 13 63,670,875 (GRCm39) missense probably damaging 1.00
R8077:Ptch1 UTSW 13 63,688,626 (GRCm39) missense probably damaging 0.98
R8373:Ptch1 UTSW 13 63,688,982 (GRCm39) missense probably damaging 1.00
R8398:Ptch1 UTSW 13 63,672,939 (GRCm39) missense probably benign 0.06
R8407:Ptch1 UTSW 13 63,662,057 (GRCm39) missense probably null 1.00
R8839:Ptch1 UTSW 13 63,689,038 (GRCm39) missense probably damaging 1.00
R9075:Ptch1 UTSW 13 63,681,335 (GRCm39) missense possibly damaging 0.87
R9476:Ptch1 UTSW 13 63,681,448 (GRCm39) missense probably benign 0.05
R9514:Ptch1 UTSW 13 63,675,071 (GRCm39) missense probably benign
R9528:Ptch1 UTSW 13 63,661,615 (GRCm39) missense probably benign 0.00
R9568:Ptch1 UTSW 13 63,689,987 (GRCm39) missense probably damaging 0.99
Z1177:Ptch1 UTSW 13 63,668,093 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGAAGCATTCTGCCAAGGCAC -3'
(R):5'- AGCTTTTGTGGATGCAGACCATCAG -3'

Sequencing Primer
(F):5'- CAAGGCACCCACATGTCC -3'
(R):5'- TTGTGGATGCAGACCATCAGATAAG -3'
Posted On 2014-04-24