Incidental Mutation 'R1593:Tex19.1'
ID175629
Institutional Source Beutler Lab
Gene Symbol Tex19.1
Ensembl Gene ENSMUSG00000039329
Gene Nametestis expressed gene 19.1
Synonyms2410081M02Rik, Tex19, Tex19.1
MMRRC Submission 039630-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R1593 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location121146143-121148319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121147253 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 146 (W146R)
Ref Sequence ENSEMBL: ENSMUSP00000048592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039088] [ENSMUST00000155694]
Predicted Effect probably damaging
Transcript: ENSMUST00000039088
AA Change: W146R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048592
Gene: ENSMUSG00000039329
AA Change: W146R

DomainStartEndE-ValueType
Pfam:TEX19 1 164 2.3e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155694
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased fertility, which in males is due to impaired spermatogenesis and increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,481,755 I902N possibly damaging Het
Acsl6 A G 11: 54,323,308 D88G probably damaging Het
Adam1a A C 5: 121,519,643 I529S probably benign Het
Ap3b1 T C 13: 94,501,927 V838A unknown Het
Arrdc2 T C 8: 70,837,120 Y280C probably damaging Het
Atg10 T C 13: 91,154,261 T53A probably benign Het
Ccdc136 T C 6: 29,415,584 S699P probably damaging Het
Cdc23 C A 18: 34,636,326 V462L possibly damaging Het
Clcn6 C T 4: 148,014,594 A431T probably benign Het
Cntn6 T G 6: 104,832,580 H525Q possibly damaging Het
Ctr9 T C 7: 111,042,853 F296S possibly damaging Het
Ctsq T A 13: 61,036,172 probably null Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Epha6 A T 16: 60,424,904 F311I probably damaging Het
Esrrg A T 1: 188,066,385 T150S possibly damaging Het
Exoc2 C A 13: 30,856,761 R758L possibly damaging Het
Exosc7 G C 9: 123,131,993 V242L probably benign Het
Fcho2 T C 13: 98,784,807 D190G possibly damaging Het
Fgd6 T C 10: 94,045,032 S583P probably damaging Het
Frmd4a A G 2: 4,473,188 Y60C probably damaging Het
Gldc A T 19: 30,113,750 I815N probably damaging Het
Grm2 A T 9: 106,650,914 L257Q probably damaging Het
Hectd3 C A 4: 116,997,020 T289K possibly damaging Het
Itgb4 T C 11: 115,980,991 V207A probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Meis2 T A 2: 116,000,264 D256V probably damaging Het
Muc4 A G 16: 32,754,686 N1520S probably benign Het
Nckap1l A G 15: 103,478,854 R719G probably null Het
Olfr800 A T 10: 129,660,225 R140* probably null Het
Pabpc6 A T 17: 9,667,813 M603K probably damaging Het
Pcnx2 C A 8: 125,759,273 R1862L probably benign Het
Pon2 T C 6: 5,273,003 D122G probably benign Het
Ppig T A 2: 69,749,081 W378R unknown Het
Ralgapa1 T A 12: 55,770,703 E389D probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rarg A G 15: 102,239,941 F233L probably damaging Het
Rasgrp2 T C 19: 6,403,460 F90L possibly damaging Het
Rrp12 T A 19: 41,863,241 H1285L probably benign Het
Slc16a13 C A 11: 70,219,082 A198S probably benign Het
Spag9 A G 11: 94,097,233 D441G probably damaging Het
Stxbp5l A G 16: 37,116,052 F1099S probably damaging Het
Tmem8 T A 17: 26,118,407 I399N possibly damaging Het
Tmod3 T C 9: 75,511,163 D197G probably benign Het
Tpp2 A G 1: 43,975,433 H644R probably benign Het
Trpm2 A G 10: 77,943,076 V352A possibly damaging Het
Tulp1 T C 17: 28,362,701 K233E probably damaging Het
Vsir A G 10: 60,357,958 T67A possibly damaging Het
Wdr49 T C 3: 75,396,941 N487S probably benign Het
Zbtb20 A G 16: 43,609,423 N99S probably damaging Het
Zfp583 C T 7: 6,317,009 G335S probably benign Het
Zgrf1 T A 3: 127,561,026 V98E possibly damaging Het
Other mutations in Tex19.1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Tex19.1 APN 11 121147246 missense probably damaging 0.98
R1420:Tex19.1 UTSW 11 121147046 missense probably damaging 0.97
R5113:Tex19.1 UTSW 11 121147799 missense probably benign 0.41
R6906:Tex19.1 UTSW 11 121147122 missense probably benign 0.42
R7389:Tex19.1 UTSW 11 121147160 missense possibly damaging 0.92
R8049:Tex19.1 UTSW 11 121147322 missense not run
X0026:Tex19.1 UTSW 11 121147046 missense possibly damaging 0.84
Z1176:Tex19.1 UTSW 11 121147563 missense not run
Predicted Primers PCR Primer
(F):5'- GTCCCTTTATGTGCCACAGAGTGTC -3'
(R):5'- GCTGCCCAACTTCTTTCCGAAAATG -3'

Sequencing Primer
(F):5'- TGCCACAGAGTGTCTCTGAAG -3'
(R):5'- GGACAAACTTCTGGTCTTGCAAC -3'
Posted On2014-04-24