Incidental Mutation 'R1569:Fcrl1'
ID177099
Institutional Source Beutler Lab
Gene Symbol Fcrl1
Ensembl Gene ENSMUSG00000059994
Gene NameFc receptor-like 1
SynonymsFcrh1, BXMAS1-like, IFGP1, moFcRH1L, moFcRH1S, A230020G22Rik, mBXMH1, moFcRH1, mIFGP1
MMRRC Submission 039608-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1569 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87376387-87402934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87384705 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 57 (Y57C)
Ref Sequence ENSEMBL: ENSMUSP00000128235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072480] [ENSMUST00000163661] [ENSMUST00000167200] [ENSMUST00000191666] [ENSMUST00000194786]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072480
AA Change: Y57C

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072300
Gene: ENSMUSG00000059994
AA Change: Y57C

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 28 113 4.03e-8 SMART
IG 123 204 1.35e0 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163661
AA Change: Y77C

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130936
Gene: ENSMUSG00000059994
AA Change: Y77C

DomainStartEndE-ValueType
IG 48 133 4.03e-8 SMART
IG 143 224 1.35e0 SMART
transmembrane domain 241 263 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167200
AA Change: Y57C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128235
Gene: ENSMUSG00000059994
AA Change: Y57C

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 28 113 4.03e-8 SMART
IG 123 204 1.35e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191666
AA Change: Y57C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141916
Gene: ENSMUSG00000059994
AA Change: Y57C

DomainStartEndE-ValueType
IG_like 9 94 4.5e-2 SMART
IG 28 113 1.7e-10 SMART
IG 123 204 5.5e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193854
Predicted Effect probably damaging
Transcript: ENSMUST00000194786
AA Change: Y57C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142286
Gene: ENSMUSG00000059994
AA Change: Y57C

DomainStartEndE-ValueType
IG_like 9 94 4.5e-2 SMART
IG 28 113 1.7e-10 SMART
IG 123 204 5.5e-3 SMART
transmembrane domain 221 243 N/A INTRINSIC
Meta Mutation Damage Score 0.5682 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein contains three extracellular C2-like immunoglobulin domains, a transmembrane domain and a cytoplasmic domain with two immunoreceptor-tyrosine activation motifs. This protein may play a role in the regulation of cancer cell growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,797 K166* probably null Het
Abca2 T A 2: 25,439,185 N1012K probably benign Het
Ahnak T C 19: 9,004,094 V914A possibly damaging Het
Akap1 T A 11: 88,833,180 M833L probably benign Het
Atp2b1 T A 10: 98,987,326 H249Q probably benign Het
Atp6v0a4 A G 6: 38,050,625 V750A probably damaging Het
Car6 T C 4: 150,201,042 Y23C probably damaging Het
Celsr3 A G 9: 108,829,068 T917A probably damaging Het
Clmn C A 12: 104,781,081 D736Y probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dennd4c G A 4: 86,786,094 R282H possibly damaging Het
Dsg1b T A 18: 20,396,480 N327K probably damaging Het
Eftud2 A T 11: 102,854,771 probably benign Het
Esyt1 G T 10: 128,518,994 S512R possibly damaging Het
Fam124b T C 1: 80,213,135 Y177C possibly damaging Het
Fbxl5 A T 5: 43,765,461 I205K probably damaging Het
Gabpb1 A T 2: 126,652,251 D151E probably benign Het
Gcc2 C T 10: 58,270,171 L310F probably benign Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Htr1b A G 9: 81,632,287 V89A probably benign Het
Ibsp A T 5: 104,310,151 T185S probably damaging Het
Igfn1 T C 1: 135,969,033 D1265G probably benign Het
Ints9 T C 14: 64,980,122 Y33H possibly damaging Het
Kif1a A T 1: 93,058,810 probably benign Het
Lama1 A T 17: 67,780,618 probably null Het
Lbp A T 2: 158,319,687 D223V probably damaging Het
Lck C A 4: 129,555,656 D283Y probably damaging Het
Lcmt2 A G 2: 121,139,828 F258S probably damaging Het
Lsg1 G T 16: 30,581,005 probably null Het
Maip1 T C 1: 57,413,395 probably benign Het
Mark3 T G 12: 111,633,746 I465S probably benign Het
Marveld2 C T 13: 100,600,998 V128I probably benign Het
Mcm3ap A G 10: 76,483,188 H750R possibly damaging Het
Mdn1 A T 4: 32,723,501 Q2479L probably null Het
Met A T 6: 17,531,504 K594* probably null Het
Pak2 G T 16: 32,037,295 S241R probably damaging Het
Plxna4 T C 6: 32,185,475 I1368V possibly damaging Het
Pparg T C 6: 115,439,999 I51T probably benign Het
Ppp1r18 A G 17: 35,868,703 E62G probably damaging Het
Prkag2 T C 5: 24,947,477 S86G possibly damaging Het
Rabgap1l A T 1: 160,702,390 I347K probably benign Het
Rdh1 A T 10: 127,763,072 M141L probably benign Het
Rfx2 A T 17: 56,804,326 I82N possibly damaging Het
Sh2b2 G A 5: 136,231,735 A209V possibly damaging Het
Sh3d19 G A 3: 86,126,644 R768H possibly damaging Het
Sh3rf1 C T 8: 61,384,862 P814S probably damaging Het
Shbg T A 11: 69,617,589 probably benign Het
Slc15a2 T C 16: 36,756,383 T430A probably benign Het
Slc17a3 A T 13: 23,855,608 I250F probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 A G 2: 122,101,706 S552P probably damaging Het
Srpk2 A G 5: 23,514,026 I597T probably damaging Het
St6galnac1 T G 11: 116,769,271 N72T possibly damaging Het
Tecpr2 T A 12: 110,944,887 probably null Het
Tmem208 T A 8: 105,334,830 C163S possibly damaging Het
Tpte T C 8: 22,345,031 V401A probably damaging Het
Trhde A G 10: 114,446,188 W795R possibly damaging Het
Trpm3 G A 19: 22,889,445 probably null Het
Ttn T A 2: 76,795,719 T14999S possibly damaging Het
Txndc2 A T 17: 65,638,926 N85K probably benign Het
Yes1 A G 5: 32,653,163 Y192C probably damaging Het
Zan A G 5: 137,429,130 V2415A unknown Het
Zfp410 T A 12: 84,332,952 C311S probably damaging Het
Zfp51 A T 17: 21,456,380 M38L probably benign Het
Zfp560 A T 9: 20,348,715 C284S possibly damaging Het
Zfp808 C T 13: 62,172,900 R648* probably null Het
Zfp976 G T 7: 42,613,382 H344N probably damaging Het
Other mutations in Fcrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Fcrl1 APN 3 87389635 missense probably damaging 0.99
IGL01884:Fcrl1 APN 3 87384737 missense probably damaging 1.00
IGL02029:Fcrl1 APN 3 87376487 utr 5 prime probably benign
IGL02231:Fcrl1 APN 3 87385162 missense possibly damaging 0.94
IGL02231:Fcrl1 APN 3 87385163 missense probably damaging 1.00
IGL02405:Fcrl1 APN 3 87385767 missense probably damaging 0.99
IGL02858:Fcrl1 APN 3 87384705 missense probably damaging 1.00
IGL03133:Fcrl1 APN 3 87389392 missense probably benign 0.00
IGL03176:Fcrl1 APN 3 87391257 missense probably damaging 1.00
IGL03352:Fcrl1 APN 3 87385091 missense probably benign 0.01
R1497:Fcrl1 UTSW 3 87384802 missense probably damaging 1.00
R1581:Fcrl1 UTSW 3 87385723 missense possibly damaging 0.94
R1778:Fcrl1 UTSW 3 87385319 splice site probably benign
R1959:Fcrl1 UTSW 3 87376520 missense possibly damaging 0.92
R2928:Fcrl1 UTSW 3 87391257 missense probably benign 0.19
R4677:Fcrl1 UTSW 3 87390256 missense possibly damaging 0.61
R5122:Fcrl1 UTSW 3 87385774 missense probably benign 0.35
R5507:Fcrl1 UTSW 3 87391242 missense probably benign 0.16
R6363:Fcrl1 UTSW 3 87385168 missense probably damaging 0.96
R6478:Fcrl1 UTSW 3 87389639 missense probably benign 0.41
R6559:Fcrl1 UTSW 3 87391253 missense probably benign 0.33
R6985:Fcrl1 UTSW 3 87389650 missense probably benign
R7291:Fcrl1 UTSW 3 87385781 critical splice donor site probably null
Z1177:Fcrl1 UTSW 3 87389363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGGCAGGTTCACAGCAAAG -3'
(R):5'- TTACCTCTGACGTGGATGCTCACC -3'

Sequencing Primer
(F):5'- GGAGATGACATCACATTCTCTACGG -3'
(R):5'- TCACCAGCTCACTGGGGATAG -3'
Posted On2014-04-24