Mutagenetix > Incidental Mutation

Incidental Mutation 'R1569:Trhde'

177130

Institutional Source

Beutler Lab

Gene Symbol

Trhde

Ensembl Gene

ENSMUSG00000050663

Gene Name

TRH-degrading enzyme

Synonyms

MMRRC Submission

039608-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R1569 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114398823-114802307 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 114446188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 795 (W795R)

Ref Sequence

ENSEMBL: ENSMUSP00000057449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061632]

AlphaFold

Q8K093

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061632
AA Change: W795R

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000057449
Gene: ENSMUSG00000050663
AA Change: W795R

Domain	Start	End	E-Value	Type
transmembrane domain	40	62	N/A	INTRINSIC
Pfam:Peptidase_M1	141	531	2.6e-141	PFAM
Pfam:ERAP1_C	679	1004	5.7e-65	PFAM

Meta Mutation Damage Score

0.2656

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.3%

Validation Efficiency

96% (72/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M1 family. The encoded protein is an extracellular peptidase that specifically cleaves and inactivates the neuropeptide thyrotropin-releasing hormone.[provided by RefSeq, Dec 2008]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	A	9: 124,293,797	K166*	probably null	Het
Abca2	T	A	2: 25,439,185	N1012K	probably benign	Het
Ahnak	T	C	19: 9,004,094	V914A	possibly damaging	Het
Akap1	T	A	11: 88,833,180	M833L	probably benign	Het
Atp2b1	T	A	10: 98,987,326	H249Q	probably benign	Het
Atp6v0a4	A	G	6: 38,050,625	V750A	probably damaging	Het
Car6	T	C	4: 150,201,042	Y23C	probably damaging	Het
Celsr3	A	G	9: 108,829,068	T917A	probably damaging	Het
Clmn	C	A	12: 104,781,081	D736Y	probably damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dennd4c	G	A	4: 86,786,094	R282H	possibly damaging	Het
Dsg1b	T	A	18: 20,396,480	N327K	probably damaging	Het
Eftud2	A	T	11: 102,854,771		probably benign	Het
Esyt1	G	T	10: 128,518,994	S512R	possibly damaging	Het
Fam124b	T	C	1: 80,213,135	Y177C	possibly damaging	Het
Fbxl5	A	T	5: 43,765,461	I205K	probably damaging	Het
Fcrl1	A	G	3: 87,384,705	Y57C	probably damaging	Het
Gabpb1	A	T	2: 126,652,251	D151E	probably benign	Het
Gcc2	C	T	10: 58,270,171	L310F	probably benign	Het
Hsd11b1	C	G	1: 193,240,327	E141Q	probably damaging	Het
Htr1b	A	G	9: 81,632,287	V89A	probably benign	Het
Ibsp	A	T	5: 104,310,151	T185S	probably damaging	Het
Igfn1	T	C	1: 135,969,033	D1265G	probably benign	Het
Ints9	T	C	14: 64,980,122	Y33H	possibly damaging	Het
Kif1a	A	T	1: 93,058,810		probably benign	Het
Lama1	A	T	17: 67,780,618		probably null	Het
Lbp	A	T	2: 158,319,687	D223V	probably damaging	Het
Lck	C	A	4: 129,555,656	D283Y	probably damaging	Het
Lcmt2	A	G	2: 121,139,828	F258S	probably damaging	Het
Lsg1	G	T	16: 30,581,005		probably null	Het
Maip1	T	C	1: 57,413,395		probably benign	Het
Mark3	T	G	12: 111,633,746	I465S	probably benign	Het
Marveld2	C	T	13: 100,600,998	V128I	probably benign	Het
Mcm3ap	A	G	10: 76,483,188	H750R	possibly damaging	Het
Mdn1	A	T	4: 32,723,501	Q2479L	probably null	Het
Met	A	T	6: 17,531,504	K594*	probably null	Het
Pak2	G	T	16: 32,037,295	S241R	probably damaging	Het
Plxna4	T	C	6: 32,185,475	I1368V	possibly damaging	Het
Pparg	T	C	6: 115,439,999	I51T	probably benign	Het
Ppp1r18	A	G	17: 35,868,703	E62G	probably damaging	Het
Prkag2	T	C	5: 24,947,477	S86G	possibly damaging	Het
Rabgap1l	A	T	1: 160,702,390	I347K	probably benign	Het
Rdh1	A	T	10: 127,763,072	M141L	probably benign	Het
Rfx2	A	T	17: 56,804,326	I82N	possibly damaging	Het
Sh2b2	G	A	5: 136,231,735	A209V	possibly damaging	Het
Sh3d19	G	A	3: 86,126,644	R768H	possibly damaging	Het
Sh3rf1	C	T	8: 61,384,862	P814S	probably damaging	Het
Shbg	T	A	11: 69,617,589		probably benign	Het
Slc15a2	T	C	16: 36,756,383	T430A	probably benign	Het
Slc17a3	A	T	13: 23,855,608	I250F	probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spg11	A	G	2: 122,101,706	S552P	probably damaging	Het
Srpk2	A	G	5: 23,514,026	I597T	probably damaging	Het
St6galnac1	T	G	11: 116,769,271	N72T	possibly damaging	Het
Tecpr2	T	A	12: 110,944,887		probably null	Het
Tmem208	T	A	8: 105,334,830	C163S	possibly damaging	Het
Tpte	T	C	8: 22,345,031	V401A	probably damaging	Het
Trpm3	G	A	19: 22,889,445		probably null	Het
Ttn	T	A	2: 76,795,719	T14999S	possibly damaging	Het
Txndc2	A	T	17: 65,638,926	N85K	probably benign	Het
Yes1	A	G	5: 32,653,163	Y192C	probably damaging	Het
Zan	A	G	5: 137,429,130	V2415A	unknown	Het
Zfp410	T	A	12: 84,332,952	C311S	probably damaging	Het
Zfp51	A	T	17: 21,456,380	M38L	probably benign	Het
Zfp560	A	T	9: 20,348,715	C284S	possibly damaging	Het
Zfp808	C	T	13: 62,172,900	R648*	probably null	Het
Zfp976	G	T	7: 42,613,382	H344N	probably damaging	Het

Other mutations in Trhde

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Trhde	APN	10	114486747	missense	possibly damaging	0.77
IGL00516:Trhde	APN	10	114446199	missense	probably benign	0.01
IGL01371:Trhde	APN	10	114588500	missense	possibly damaging	0.57
IGL01488:Trhde	APN	10	114446158	missense	possibly damaging	0.58
IGL01602:Trhde	APN	10	114787943	missense	probably benign
IGL01605:Trhde	APN	10	114787943	missense	probably benign
IGL02150:Trhde	APN	10	114592108	missense	probably damaging	1.00
IGL02165:Trhde	APN	10	114592161	missense	probably damaging	1.00
IGL02340:Trhde	APN	10	114592213	splice site	probably benign
IGL02412:Trhde	APN	10	114486925	missense	probably damaging	1.00
IGL02421:Trhde	APN	10	114412461	missense	probably damaging	1.00
IGL02496:Trhde	APN	10	114800561	nonsense	probably null
IGL02952:Trhde	APN	10	114800573	missense	probably damaging	0.99
IGL03197:Trhde	APN	10	114413308	missense	probably benign	0.00
Cata	UTSW	10	114592066	missense	probably damaging	1.00
l3-37	UTSW	10	114801081	missense	probably benign
Pelte	UTSW	10	114486704	critical splice donor site	probably null
G1Funyon:Trhde	UTSW	10	114487006	missense	probably benign	0.03
R0360:Trhde	UTSW	10	114502982	splice site	probably benign
R0364:Trhde	UTSW	10	114502982	splice site	probably benign
R0457:Trhde	UTSW	10	114448262	missense	probably benign	0.37
R0589:Trhde	UTSW	10	114448324	missense	probably benign	0.01
R1132:Trhde	UTSW	10	114412478	missense	possibly damaging	0.86
R1288:Trhde	UTSW	10	114801290	missense	probably benign	0.37
R1776:Trhde	UTSW	10	114800603	missense	probably benign	0.06
R1781:Trhde	UTSW	10	114588500	missense	possibly damaging	0.57
R1927:Trhde	UTSW	10	114800849	missense	probably damaging	1.00
R1976:Trhde	UTSW	10	114588431	missense	possibly damaging	0.57
R2011:Trhde	UTSW	10	114498793	missense	probably benign	0.02
R2332:Trhde	UTSW	10	114592165	missense	probably damaging	1.00
R2356:Trhde	UTSW	10	114401516	missense	probably damaging	1.00
R3107:Trhde	UTSW	10	114592066	missense	probably damaging	1.00
R3108:Trhde	UTSW	10	114592066	missense	probably damaging	1.00
R3907:Trhde	UTSW	10	114800696	missense	possibly damaging	0.72
R4067:Trhde	UTSW	10	114444680	nonsense	probably null
R4214:Trhde	UTSW	10	114788070	missense	possibly damaging	0.51
R4428:Trhde	UTSW	10	114503123	missense	probably damaging	1.00
R4429:Trhde	UTSW	10	114503123	missense	probably damaging	1.00
R4430:Trhde	UTSW	10	114503123	missense	probably damaging	1.00
R5244:Trhde	UTSW	10	114801081	missense	probably benign
R5456:Trhde	UTSW	10	114486760	missense	possibly damaging	0.58
R5540:Trhde	UTSW	10	114800592	missense	probably benign	0.45
R5699:Trhde	UTSW	10	114588502	missense	probably benign	0.00
R5967:Trhde	UTSW	10	114567134	missense	probably damaging	1.00
R6326:Trhde	UTSW	10	114567224	missense	probably damaging	1.00
R6467:Trhde	UTSW	10	114504198	missense	probably damaging	1.00
R7028:Trhde	UTSW	10	114518177	missense	probably damaging	1.00
R7264:Trhde	UTSW	10	114800871	missense	possibly damaging	0.93
R7266:Trhde	UTSW	10	114800871	missense	possibly damaging	0.93
R7310:Trhde	UTSW	10	114800573	missense	probably damaging	0.99
R7460:Trhde	UTSW	10	114413263	missense	probably damaging	1.00
R7732:Trhde	UTSW	10	114788064	missense	probably benign
R7842:Trhde	UTSW	10	114696098	missense	possibly damaging	0.86
R8178:Trhde	UTSW	10	114408693	missense	possibly damaging	0.93
R8209:Trhde	UTSW	10	114567228	missense	probably damaging	1.00
R8226:Trhde	UTSW	10	114567228	missense	probably damaging	1.00
R8232:Trhde	UTSW	10	114800537	missense	possibly damaging	0.90
R8301:Trhde	UTSW	10	114487006	missense	probably benign	0.03
R8312:Trhde	UTSW	10	114413287	missense	probably damaging	1.00
R8335:Trhde	UTSW	10	114486704	critical splice donor site	probably null
R8477:Trhde	UTSW	10	114800717	missense	probably benign	0.02
R8853:Trhde	UTSW	10	114800925	missense	probably benign
R8953:Trhde	UTSW	10	114503061	missense	probably damaging	0.98
R9375:Trhde	UTSW	10	114408693	missense	probably damaging	0.99
R9477:Trhde	UTSW	10	114503075	missense	probably benign	0.03
R9486:Trhde	UTSW	10	114696109	missense	possibly damaging	0.89
R9502:Trhde	UTSW	10	114800792	missense	probably damaging	1.00
Z1177:Trhde	UTSW	10	114448389	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTGCAGGTTCTGATCCCAAGATCAC -3'
(R):5'- TGGCATCTACTCACATAGGCACCC -3'

Sequencing Primer
(F):5'- GCAGCAAAAACTGTGTTGCTC -3'
(R):5'- cacccagacctatgcaaaaac -3'

Posted On

2014-04-24