Incidental Mutation 'R1699:Ttyh1'
ID192514
Institutional Source Beutler Lab
Gene Symbol Ttyh1
Ensembl Gene ENSMUSG00000030428
Gene Nametweety family member 1
Synonyms6330408P11Rik, tty, 4930459B04Rik
MMRRC Submission 039732-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1699 (G1)
Quality Score87
Status Not validated
Chromosome7
Chromosomal Location4119408-4136708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4119696 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 14 (H14Q)
Ref Sequence ENSEMBL: ENSMUSP00000146170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032594] [ENSMUST00000079415] [ENSMUST00000119661] [ENSMUST00000129423] [ENSMUST00000153673] [ENSMUST00000206987] [ENSMUST00000206869]
Predicted Effect probably benign
Transcript: ENSMUST00000032594
SMART Domains Protein: ENSMUSP00000032594
Gene: ENSMUSG00000030428

DomainStartEndE-ValueType
Pfam:Tweety 1 72 4.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050989
Predicted Effect probably benign
Transcript: ENSMUST00000079415
AA Change: H14Q

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000078384
Gene: ENSMUSG00000030428
AA Change: H14Q

DomainStartEndE-ValueType
Pfam:Tweety 26 428 3.2e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119661
AA Change: H14Q

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113937
Gene: ENSMUSG00000030428
AA Change: H14Q

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126971
Predicted Effect probably benign
Transcript: ENSMUST00000129423
AA Change: H14Q

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120182
Gene: ENSMUSG00000030428
AA Change: H14Q

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151959
Predicted Effect possibly damaging
Transcript: ENSMUST00000153673
AA Change: H14Q

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115623
Gene: ENSMUSG00000030428
AA Change: H14Q

DomainStartEndE-ValueType
Pfam:Tweety 26 103 1.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206987
AA Change: H14Q

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000206869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154825
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Tweety family of membrane proteins. Members of this family contain five predicted transmembrane regions that are arranged in a characteristic pattern. In mouse, the protein is predominantly localized to the endoplasmic reticulum and displays calcium binding activity. Targeted knock out of this gene results in early embryonic lethality prior to the blastocyst stage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation with arrest before the blastocyst stage and mitotic failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,483,866 probably null Het
Abca2 A G 2: 25,447,351 E2406G possibly damaging Het
Adam6b T A 12: 113,490,585 F341I probably benign Het
Adam8 A T 7: 139,983,311 N767K possibly damaging Het
AI481877 T C 4: 59,113,926 K13R unknown Het
Aig1 T C 10: 13,868,622 D46G possibly damaging Het
Alms1 A G 6: 85,622,880 I2032V possibly damaging Het
Ankrd16 A G 2: 11,784,393 I264V probably benign Het
Areg T G 5: 91,143,498 V100G probably damaging Het
Bcan A G 3: 87,989,236 Y718H probably damaging Het
Brsk2 T A 7: 141,985,463 I188N probably damaging Het
Ccdc189 A T 7: 127,586,856 probably null Het
Cdt1 T C 8: 122,569,983 Y203H probably damaging Het
Chil3 A C 3: 106,160,366 probably null Het
Cth A G 3: 157,907,436 L253P probably damaging Het
Cyp11b1 A G 15: 74,840,817 F132L possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah11 A G 12: 118,190,868 S226P probably damaging Het
Egfr A T 11: 16,859,019 Q71L probably benign Het
Eml6 T A 11: 29,746,282 K1940* probably null Het
Epn2 T A 11: 61,523,188 K391* probably null Het
Erich1 A T 8: 14,090,259 S2T possibly damaging Het
Evi5 A C 5: 107,818,920 L245R probably damaging Het
Evpl T C 11: 116,227,588 Y731C probably damaging Het
Exoc3l G A 8: 105,295,013 H128Y probably benign Het
Extl1 G A 4: 134,364,583 Q320* probably null Het
Fam71a T A 1: 191,163,821 E208D probably benign Het
Fam91a1 T A 15: 58,432,948 S416T probably benign Het
Fam96b A G 8: 104,640,086 V132A probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fer1l4 A G 2: 156,029,685 F1392L probably benign Het
Fstl4 T C 11: 53,168,178 I488T possibly damaging Het
Gak A T 5: 108,604,377 Y338* probably null Het
Glp2r T C 11: 67,757,541 T112A probably benign Het
Glrb G A 3: 80,861,774 T180I probably damaging Het
Gm10118 C T 10: 63,926,892 probably benign Het
Gpr19 A T 6: 134,870,229 F72I possibly damaging Het
Grin3b C A 10: 79,975,882 N740K probably damaging Het
Gstk1 A T 6: 42,246,601 T42S probably benign Het
Hoxd1 G A 2: 74,764,282 A294T probably benign Het
Hspg2 T A 4: 137,548,012 probably null Het
Ift74 A T 4: 94,685,703 N472I probably benign Het
Il1a C T 2: 129,302,893 D202N probably damaging Het
Islr T C 9: 58,157,495 D243G probably damaging Het
Kif21a C T 15: 90,959,743 E1098K probably damaging Het
Krtap16-1 T C 11: 99,986,026 E184G probably damaging Het
Lrp1b A G 2: 41,185,962 I1889T possibly damaging Het
Mcpt4 A G 14: 56,059,959 *247Q probably null Het
Megf10 T C 18: 57,277,730 probably null Het
Mettl2 T A 11: 105,139,718 H373Q probably benign Het
Mocos A G 18: 24,683,216 K617E probably damaging Het
Ms4a8a A G 19: 11,076,397 I115T probably damaging Het
Ndst1 T C 18: 60,695,508 Y658C probably damaging Het
Nin G A 12: 70,030,938 A1031V probably benign Het
Nin C A 12: 70,045,563 K657N possibly damaging Het
Noc4l G A 5: 110,649,847 R344* probably null Het
Notch2 T C 3: 98,145,127 S1980P probably damaging Het
Npat C T 9: 53,562,660 S584L probably benign Het
Nphp4 A G 4: 152,496,664 T102A probably damaging Het
Olfml2b A G 1: 170,645,073 N51S possibly damaging Het
Olfr1042 T C 2: 86,159,936 I145V probably benign Het
Olfr138 A G 17: 38,275,041 K90R probably benign Het
Olfr1388 T A 11: 49,444,289 I146N possibly damaging Het
Olfr153 A G 2: 87,532,083 T17A probably benign Het
Pced1b T A 15: 97,384,877 W266R probably damaging Het
Pdcd6ip A G 9: 113,678,354 V378A probably damaging Het
Pde8b T A 13: 95,032,866 K683N probably damaging Het
Pfas T G 11: 68,998,046 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcd4 T G 1: 74,548,235 S51R probably benign Het
Plekhh2 T A 17: 84,577,184 Y775* probably null Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Ppp4r3b C T 11: 29,213,765 T47I possibly damaging Het
Pter A T 2: 12,994,761 D169V probably damaging Het
Ptpn12 A G 5: 20,998,170 S537P probably benign Het
Ptpru T A 4: 131,779,050 D1067V probably damaging Het
Rcn1 A T 2: 105,399,005 D67E probably damaging Het
Rfc4 T C 16: 23,114,233 E318G probably benign Het
Samd13 C A 3: 146,662,714 R41L probably benign Het
Slc6a2 T C 8: 92,972,812 I156T possibly damaging Het
Spag16 T C 1: 69,996,856 F348L probably benign Het
Spag4 T C 2: 156,065,422 Y21H probably damaging Het
Stam2 G A 2: 52,703,175 A368V possibly damaging Het
Stc1 A T 14: 69,038,327 M190L probably benign Het
Stxbp1 A G 2: 32,800,617 L475P probably damaging Het
Syn3 A T 10: 86,080,211 Y304N probably damaging Het
Tbc1d15 G T 10: 115,220,314 T251K probably benign Het
Tbpl2 A T 2: 24,095,045 M29K probably benign Het
Tead3 T G 17: 28,334,724 Q170H possibly damaging Het
Tpbpb T C 13: 60,902,163 N51D probably benign Het
Tstd3 A G 4: 21,759,400 M124T probably benign Het
Tubgcp4 G A 2: 121,189,893 W449* probably null Het
Txndc11 A G 16: 11,087,775 probably null Het
Usp24 T A 4: 106,438,827 D2615E probably damaging Het
Vars A G 17: 35,014,758 E1020G possibly damaging Het
Vmn2r58 A G 7: 41,860,527 I542T probably benign Het
Vwf A G 6: 125,643,069 Y1570C probably damaging Het
Vwf A T 6: 125,685,900 Y2749F possibly damaging Het
Zfand1 A C 3: 10,341,055 V198G possibly damaging Het
Zfp536 G A 7: 37,569,454 T179I probably damaging Het
Zfp599 T C 9: 22,250,404 Y155C probably benign Het
Other mutations in Ttyh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ttyh1 APN 7 4124657 missense probably damaging 1.00
IGL01730:Ttyh1 APN 7 4125721 missense possibly damaging 0.90
IGL02052:Ttyh1 APN 7 4130574 unclassified probably benign
IGL02410:Ttyh1 APN 7 4133899 utr 3 prime probably benign
IGL02651:Ttyh1 APN 7 4124679 missense probably damaging 1.00
PIT4468001:Ttyh1 UTSW 7 4119772 missense possibly damaging 0.49
R0137:Ttyh1 UTSW 7 4124720 missense possibly damaging 0.95
R1739:Ttyh1 UTSW 7 4129349 missense probably benign 0.18
R1865:Ttyh1 UTSW 7 4119731 missense probably damaging 1.00
R2258:Ttyh1 UTSW 7 4128184 missense probably damaging 0.98
R2259:Ttyh1 UTSW 7 4128184 missense probably damaging 0.98
R2260:Ttyh1 UTSW 7 4128184 missense probably damaging 0.98
R3027:Ttyh1 UTSW 7 4119722 missense probably benign 0.31
R3426:Ttyh1 UTSW 7 4133219 critical splice donor site probably null
R3939:Ttyh1 UTSW 7 4129318 missense probably damaging 0.97
R3941:Ttyh1 UTSW 7 4129318 missense probably damaging 0.97
R4328:Ttyh1 UTSW 7 4130581 missense probably damaging 0.99
R4329:Ttyh1 UTSW 7 4130581 missense probably damaging 0.99
R4527:Ttyh1 UTSW 7 4119764 missense probably damaging 1.00
R4849:Ttyh1 UTSW 7 4122534 missense possibly damaging 0.84
R4898:Ttyh1 UTSW 7 4133736 missense probably benign 0.03
R4931:Ttyh1 UTSW 7 4133944 utr 3 prime probably benign
R4960:Ttyh1 UTSW 7 4128226 missense probably damaging 1.00
R6158:Ttyh1 UTSW 7 4125562 missense probably benign 0.00
R6362:Ttyh1 UTSW 7 4129324 missense possibly damaging 0.67
R6799:Ttyh1 UTSW 7 4133222 splice site probably null
R6823:Ttyh1 UTSW 7 4122529 missense probably damaging 0.97
R6897:Ttyh1 UTSW 7 4124650 utr 3 prime probably benign
R7070:Ttyh1 UTSW 7 4133364 missense probably damaging 0.99
R7236:Ttyh1 UTSW 7 4133664 missense probably benign 0.00
R7287:Ttyh1 UTSW 7 4125658 missense probably benign 0.02
R8039:Ttyh1 UTSW 7 4122541 missense probably benign 0.01
R8056:Ttyh1 UTSW 7 4124623 intron probably benign
R8236:Ttyh1 UTSW 7 4125548 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGTTCTCAGCAAGCACAGCCC -3'
(R):5'- ACTTGTACTCACAAATGCAGGCCG -3'

Sequencing Primer
(F):5'- GAGGCAGCACTGAGgcg -3'
(R):5'- TGCTGGTACTCTTGGTCGC -3'
Posted On2014-05-14