Incidental Mutation 'R1699:Kif21a'
ID192559
Institutional Source Beutler Lab
Gene Symbol Kif21a
Ensembl Gene ENSMUSG00000022629
Gene Namekinesin family member 21A
SynonymsN-5 kinesin
MMRRC Submission 039732-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1699 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location90933276-91049948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90959743 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1098 (E1098K)
Ref Sequence ENSEMBL: ENSMUSP00000104911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288] [ENSMUST00000229801]
Predicted Effect probably benign
Transcript: ENSMUST00000067205
AA Change: E1105K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629
AA Change: E1105K

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1251 1271 N/A INTRINSIC
WD40 1290 1327 1.21e-7 SMART
WD40 1330 1368 7.28e-2 SMART
WD40 1394 1432 3.33e-1 SMART
WD40 1435 1477 7e-4 SMART
WD40 1485 1523 2.4e-1 SMART
WD40 1527 1566 1.48e-2 SMART
WD40 1569 1606 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088614
AA Change: E1118K

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629
AA Change: E1118K

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100304
AA Change: E1118K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629
AA Change: E1118K

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109287
AA Change: E1105K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629
AA Change: E1105K

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
WD40 1229 1266 1.21e-7 SMART
WD40 1269 1307 7.28e-2 SMART
WD40 1333 1371 3.33e-1 SMART
WD40 1374 1416 7e-4 SMART
WD40 1424 1462 2.4e-1 SMART
WD40 1466 1505 1.48e-2 SMART
WD40 1508 1545 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109288
AA Change: E1098K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629
AA Change: E1098K

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
WD40 1235 1272 1.21e-7 SMART
WD40 1275 1313 7.28e-2 SMART
WD40 1339 1377 3.33e-1 SMART
WD40 1380 1422 7e-4 SMART
WD40 1430 1468 2.4e-1 SMART
WD40 1472 1511 1.48e-2 SMART
WD40 1514 1551 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229801
AA Change: E80K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229864
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,483,866 probably null Het
Abca2 A G 2: 25,447,351 E2406G possibly damaging Het
Adam6b T A 12: 113,490,585 F341I probably benign Het
Adam8 A T 7: 139,983,311 N767K possibly damaging Het
AI481877 T C 4: 59,113,926 K13R unknown Het
Aig1 T C 10: 13,868,622 D46G possibly damaging Het
Alms1 A G 6: 85,622,880 I2032V possibly damaging Het
Ankrd16 A G 2: 11,784,393 I264V probably benign Het
Areg T G 5: 91,143,498 V100G probably damaging Het
Bcan A G 3: 87,989,236 Y718H probably damaging Het
Brsk2 T A 7: 141,985,463 I188N probably damaging Het
Ccdc189 A T 7: 127,586,856 probably null Het
Cdt1 T C 8: 122,569,983 Y203H probably damaging Het
Chil3 A C 3: 106,160,366 probably null Het
Cth A G 3: 157,907,436 L253P probably damaging Het
Cyp11b1 A G 15: 74,840,817 F132L possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah11 A G 12: 118,190,868 S226P probably damaging Het
Egfr A T 11: 16,859,019 Q71L probably benign Het
Eml6 T A 11: 29,746,282 K1940* probably null Het
Epn2 T A 11: 61,523,188 K391* probably null Het
Erich1 A T 8: 14,090,259 S2T possibly damaging Het
Evi5 A C 5: 107,818,920 L245R probably damaging Het
Evpl T C 11: 116,227,588 Y731C probably damaging Het
Exoc3l G A 8: 105,295,013 H128Y probably benign Het
Extl1 G A 4: 134,364,583 Q320* probably null Het
Fam71a T A 1: 191,163,821 E208D probably benign Het
Fam91a1 T A 15: 58,432,948 S416T probably benign Het
Fam96b A G 8: 104,640,086 V132A probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fer1l4 A G 2: 156,029,685 F1392L probably benign Het
Fstl4 T C 11: 53,168,178 I488T possibly damaging Het
Gak A T 5: 108,604,377 Y338* probably null Het
Glp2r T C 11: 67,757,541 T112A probably benign Het
Glrb G A 3: 80,861,774 T180I probably damaging Het
Gm10118 C T 10: 63,926,892 probably benign Het
Gpr19 A T 6: 134,870,229 F72I possibly damaging Het
Grin3b C A 10: 79,975,882 N740K probably damaging Het
Gstk1 A T 6: 42,246,601 T42S probably benign Het
Hoxd1 G A 2: 74,764,282 A294T probably benign Het
Hspg2 T A 4: 137,548,012 probably null Het
Ift74 A T 4: 94,685,703 N472I probably benign Het
Il1a C T 2: 129,302,893 D202N probably damaging Het
Islr T C 9: 58,157,495 D243G probably damaging Het
Krtap16-1 T C 11: 99,986,026 E184G probably damaging Het
Lrp1b A G 2: 41,185,962 I1889T possibly damaging Het
Mcpt4 A G 14: 56,059,959 *247Q probably null Het
Megf10 T C 18: 57,277,730 probably null Het
Mettl2 T A 11: 105,139,718 H373Q probably benign Het
Mocos A G 18: 24,683,216 K617E probably damaging Het
Ms4a8a A G 19: 11,076,397 I115T probably damaging Het
Ndst1 T C 18: 60,695,508 Y658C probably damaging Het
Nin G A 12: 70,030,938 A1031V probably benign Het
Nin C A 12: 70,045,563 K657N possibly damaging Het
Noc4l G A 5: 110,649,847 R344* probably null Het
Notch2 T C 3: 98,145,127 S1980P probably damaging Het
Npat C T 9: 53,562,660 S584L probably benign Het
Nphp4 A G 4: 152,496,664 T102A probably damaging Het
Olfml2b A G 1: 170,645,073 N51S possibly damaging Het
Olfr1042 T C 2: 86,159,936 I145V probably benign Het
Olfr138 A G 17: 38,275,041 K90R probably benign Het
Olfr1388 T A 11: 49,444,289 I146N possibly damaging Het
Olfr153 A G 2: 87,532,083 T17A probably benign Het
Pced1b T A 15: 97,384,877 W266R probably damaging Het
Pdcd6ip A G 9: 113,678,354 V378A probably damaging Het
Pde8b T A 13: 95,032,866 K683N probably damaging Het
Pfas T G 11: 68,998,046 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcd4 T G 1: 74,548,235 S51R probably benign Het
Plekhh2 T A 17: 84,577,184 Y775* probably null Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Ppp4r3b C T 11: 29,213,765 T47I possibly damaging Het
Pter A T 2: 12,994,761 D169V probably damaging Het
Ptpn12 A G 5: 20,998,170 S537P probably benign Het
Ptpru T A 4: 131,779,050 D1067V probably damaging Het
Rcn1 A T 2: 105,399,005 D67E probably damaging Het
Rfc4 T C 16: 23,114,233 E318G probably benign Het
Samd13 C A 3: 146,662,714 R41L probably benign Het
Slc6a2 T C 8: 92,972,812 I156T possibly damaging Het
Spag16 T C 1: 69,996,856 F348L probably benign Het
Spag4 T C 2: 156,065,422 Y21H probably damaging Het
Stam2 G A 2: 52,703,175 A368V possibly damaging Het
Stc1 A T 14: 69,038,327 M190L probably benign Het
Stxbp1 A G 2: 32,800,617 L475P probably damaging Het
Syn3 A T 10: 86,080,211 Y304N probably damaging Het
Tbc1d15 G T 10: 115,220,314 T251K probably benign Het
Tbpl2 A T 2: 24,095,045 M29K probably benign Het
Tead3 T G 17: 28,334,724 Q170H possibly damaging Het
Tpbpb T C 13: 60,902,163 N51D probably benign Het
Tstd3 A G 4: 21,759,400 M124T probably benign Het
Ttyh1 T A 7: 4,119,696 H14Q possibly damaging Het
Tubgcp4 G A 2: 121,189,893 W449* probably null Het
Txndc11 A G 16: 11,087,775 probably null Het
Usp24 T A 4: 106,438,827 D2615E probably damaging Het
Vars A G 17: 35,014,758 E1020G possibly damaging Het
Vmn2r58 A G 7: 41,860,527 I542T probably benign Het
Vwf A G 6: 125,643,069 Y1570C probably damaging Het
Vwf A T 6: 125,685,900 Y2749F possibly damaging Het
Zfand1 A C 3: 10,341,055 V198G possibly damaging Het
Zfp536 G A 7: 37,569,454 T179I probably damaging Het
Zfp599 T C 9: 22,250,404 Y155C probably benign Het
Other mutations in Kif21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Kif21a APN 15 90937301 missense probably damaging 1.00
IGL01476:Kif21a APN 15 90943864 missense possibly damaging 0.66
IGL01617:Kif21a APN 15 90995637 splice site probably benign
IGL01736:Kif21a APN 15 90959745 missense possibly damaging 0.59
IGL01923:Kif21a APN 15 90956430 missense probably damaging 0.96
IGL01985:Kif21a APN 15 90991767 missense probably damaging 1.00
IGL02304:Kif21a APN 15 90965535 missense probably damaging 1.00
IGL02589:Kif21a APN 15 90985286 missense probably damaging 1.00
IGL03115:Kif21a APN 15 90985395 missense probably damaging 0.99
IGL03211:Kif21a APN 15 90997963 missense possibly damaging 0.73
IGL03372:Kif21a APN 15 90956376 missense probably benign 0.38
reflex UTSW 15 90968358 missense probably null 1.00
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0304:Kif21a UTSW 15 90976521 splice site probably null
R0378:Kif21a UTSW 15 90969774 splice site probably null
R0420:Kif21a UTSW 15 90968054 unclassified probably benign
R0536:Kif21a UTSW 15 90959683 splice site probably benign
R0826:Kif21a UTSW 15 90997541 critical splice donor site probably null
R0971:Kif21a UTSW 15 90940581 missense possibly damaging 0.46
R1052:Kif21a UTSW 15 90935650 missense probably benign 0.17
R1168:Kif21a UTSW 15 90993753 missense probably damaging 1.00
R1324:Kif21a UTSW 15 90948322 critical splice donor site probably null
R1471:Kif21a UTSW 15 90956419 missense probably benign 0.04
R1625:Kif21a UTSW 15 90942175 missense probably damaging 1.00
R1636:Kif21a UTSW 15 90984805 splice site probably benign
R1647:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1648:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1703:Kif21a UTSW 15 90949047 intron probably null
R1795:Kif21a UTSW 15 90972727 splice site probably null
R1812:Kif21a UTSW 15 90971766 missense possibly damaging 0.63
R1959:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1960:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1961:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1996:Kif21a UTSW 15 90994371 nonsense probably null
R2230:Kif21a UTSW 15 90985362 nonsense probably null
R2231:Kif21a UTSW 15 90985362 nonsense probably null
R2232:Kif21a UTSW 15 90985362 nonsense probably null
R2424:Kif21a UTSW 15 90971196 missense probably damaging 1.00
R2429:Kif21a UTSW 15 90998005 missense probably damaging 1.00
R2513:Kif21a UTSW 15 90994391 missense possibly damaging 0.96
R2846:Kif21a UTSW 15 90934464 missense probably benign
R3027:Kif21a UTSW 15 90972642 missense probably damaging 0.99
R3624:Kif21a UTSW 15 90965595 missense probably damaging 0.99
R3820:Kif21a UTSW 15 90968074 missense probably benign 0.17
R3923:Kif21a UTSW 15 90937294 missense possibly damaging 0.46
R3962:Kif21a UTSW 15 90985409 missense probably damaging 1.00
R4355:Kif21a UTSW 15 90970833 missense probably benign 0.17
R4516:Kif21a UTSW 15 90971142 missense probably benign 0.38
R4530:Kif21a UTSW 15 90968089 unclassified probably null
R4612:Kif21a UTSW 15 90968223 unclassified probably null
R4674:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4675:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4698:Kif21a UTSW 15 90956305 missense possibly damaging 0.85
R4712:Kif21a UTSW 15 90984755 missense probably damaging 1.00
R4955:Kif21a UTSW 15 90937190 missense probably damaging 1.00
R4974:Kif21a UTSW 15 90949010 missense probably benign 0.16
R5034:Kif21a UTSW 15 90968358 missense probably null 1.00
R5165:Kif21a UTSW 15 90956376 missense probably benign 0.38
R5464:Kif21a UTSW 15 90993855 missense probably damaging 1.00
R5541:Kif21a UTSW 15 90968113 missense probably damaging 0.99
R5757:Kif21a UTSW 15 90951345 missense probably damaging 1.00
R5936:Kif21a UTSW 15 90935647 missense possibly damaging 0.95
R5976:Kif21a UTSW 15 90935812 missense probably damaging 1.00
R6074:Kif21a UTSW 15 90980892 missense probably benign
R6638:Kif21a UTSW 15 90966407 missense probably damaging 1.00
R6723:Kif21a UTSW 15 90940446 missense probably damaging 0.97
R6785:Kif21a UTSW 15 90935730 missense probably damaging 1.00
R6977:Kif21a UTSW 15 90980837 missense probably damaging 1.00
R7058:Kif21a UTSW 15 90948903 intron probably null
R7147:Kif21a UTSW 15 90980883 missense probably benign 0.13
R7290:Kif21a UTSW 15 90967229 nonsense probably null
R7438:Kif21a UTSW 15 90993796 missense probably benign 0.37
R7593:Kif21a UTSW 15 90943861 missense probably benign 0.03
R7661:Kif21a UTSW 15 90980919 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGGTTTCACTTCACCACAAAGCTTCATA -3'
(R):5'- GTCTCCTCATCCCAGCAATGCAA -3'

Sequencing Primer
(F):5'- gtccccttctccgaccc -3'
(R):5'- TCCCAGCAATGCAAGGGAAG -3'
Posted On2014-05-14