Incidental Mutation 'R1772:Pear1'
ID196666
Institutional Source Beutler Lab
Gene Symbol Pear1
Ensembl Gene ENSMUSG00000028073
Gene Nameplatelet endothelial aggregation receptor 1
SynonymsJedi-1, 3110045G13Rik
MMRRC Submission 039803-MU
Accession Numbers

Ncbi RefSeq: NM_001032413.1, NM_001032414.1, NM_028460.2, NM_152799.2; MGI:1920432

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1772 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87747890-87824306 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 87754492 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029714] [ENSMUST00000079083] [ENSMUST00000090981] [ENSMUST00000172590] [ENSMUST00000172621] [ENSMUST00000173184] [ENSMUST00000173225] [ENSMUST00000173468] [ENSMUST00000174219] [ENSMUST00000174267] [ENSMUST00000174713] [ENSMUST00000174759] [ENSMUST00000174776]
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079083
SMART Domains Protein: ENSMUSP00000078090
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172590
SMART Domains Protein: ENSMUSP00000133480
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
Blast:EGF 23 50 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172621
SMART Domains Protein: ENSMUSP00000133474
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172631
Predicted Effect probably benign
Transcript: ENSMUST00000172669
SMART Domains Protein: ENSMUSP00000134451
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
EGF_like 1 34 1.85e0 SMART
EGF 33 65 3.1e-2 SMART
EGF 76 108 2.53e1 SMART
transmembrane domain 128 150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173184
SMART Domains Protein: ENSMUSP00000134100
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:EMI 23 95 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173225
SMART Domains Protein: ENSMUSP00000134387
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173468
SMART Domains Protein: ENSMUSP00000133988
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:EMI 23 96 2.1e-16 PFAM
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF 184 215 1.84e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173747
Predicted Effect probably benign
Transcript: ENSMUST00000174219
SMART Domains Protein: ENSMUSP00000133565
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
EGF 15 47 4.03e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174267
SMART Domains Protein: ENSMUSP00000133626
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174713
SMART Domains Protein: ENSMUSP00000134215
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174759
SMART Domains Protein: ENSMUSP00000133323
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174776
SMART Domains Protein: ENSMUSP00000133749
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:EMI 23 96 6.3e-17 PFAM
Blast:FU 97 120 1e-5 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PEAR1 is a platelet receptor that signals upon the formation of platelet-platelet contacts independent of platelet activation and secondary to platelet aggregation (Nanda et al., 2005 [PubMed 15851471]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show no apparent defects in hemostasis or thrombus formation. Although in vitro dextran sulfate-induced platelet aggregation is impaired, platelet aggregation initiated with physiological agonists is normal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,432 S1937P probably damaging Het
Adgb G T 10: 10,382,721 probably benign Het
Aldh1a7 T C 19: 20,716,019 K179E probably damaging Het
Angptl7 G A 4: 148,497,426 R168C probably damaging Het
Atp8b1 T A 18: 64,573,492 I208F possibly damaging Het
Bco1 A G 8: 117,130,608 Y438C probably benign Het
Btrc A C 19: 45,512,661 K218Q probably damaging Het
Cct8l1 G A 5: 25,517,699 V471M probably damaging Het
Cd180 C T 13: 102,706,242 L599F probably benign Het
Cd300e T C 11: 115,054,518 N150S probably benign Het
Clcn1 C A 6: 42,294,145 T281K probably damaging Het
Cnnm3 T C 1: 36,518,957 S417P probably damaging Het
Cspg4 T A 9: 56,897,492 S1862R probably benign Het
Cspg5 A T 9: 110,262,138 N432Y probably damaging Het
Cyp2r1 T A 7: 114,553,216 I169F probably damaging Het
D130043K22Rik T A 13: 24,875,999 S618T probably damaging Het
Diaph3 G A 14: 86,965,549 P635L probably damaging Het
Dlg1 A G 16: 31,665,667 I38V possibly damaging Het
Dlk1 T G 12: 109,459,759 V186G probably damaging Het
Dmxl2 T C 9: 54,423,224 probably benign Het
Dnajc17 G A 2: 119,183,683 R132* probably null Het
Dock9 G T 14: 121,609,798 N1042K probably benign Het
Dok7 A T 5: 35,086,650 Q511L probably damaging Het
Espnl G A 1: 91,344,603 E562K possibly damaging Het
Evi5 G A 5: 107,795,841 T562I probably benign Het
Exd2 T A 12: 80,489,479 D294E probably benign Het
Fbn1 A T 2: 125,403,228 D246E possibly damaging Het
Fbxw16 A T 9: 109,439,582 W247R possibly damaging Het
Fcer1a A G 1: 173,225,437 I64T probably benign Het
Fcgbp C A 7: 28,105,175 Q1903K possibly damaging Het
Fmn1 A G 2: 113,365,355 S467G unknown Het
Fndc7 T A 3: 108,870,534 T369S probably damaging Het
Fnta T C 8: 26,000,966 probably benign Het
Gak A T 5: 108,606,892 H289Q probably damaging Het
Gas2l3 A G 10: 89,417,014 probably benign Het
Gbp8 T C 5: 105,016,121 N437S probably benign Het
Gk5 G A 9: 96,150,797 probably null Het
Gm21818 T A 13: 120,173,189 D2E probably benign Het
Hid1 A T 11: 115,348,473 V788E probably damaging Het
Hmcn1 T C 1: 150,563,568 T5505A probably damaging Het
Igf1r T A 7: 68,195,074 M865K probably benign Het
Katnal2 G A 18: 77,002,537 T258I probably damaging Het
Kdm3b A T 18: 34,803,504 I280L probably benign Het
Kif24 A G 4: 41,409,787 V382A probably damaging Het
Kif2a A T 13: 106,978,132 probably benign Het
Klhl10 A G 11: 100,442,196 I56V probably benign Het
Klk6 C T 7: 43,829,271 Q201* probably null Het
Klra3 A T 6: 130,323,708 S233T probably benign Het
Krt9 A T 11: 100,191,305 M223K probably damaging Het
Lama4 G A 10: 39,060,224 E632K probably benign Het
Lamb1 T C 12: 31,278,525 Y163H probably damaging Het
Lipo1 A G 19: 33,787,421 I11T probably benign Het
Lix1l T A 3: 96,623,891 H333Q possibly damaging Het
Mal2 T A 15: 54,588,387 M68K probably damaging Het
Map2k2 T C 10: 81,121,100 I104T probably damaging Het
Matn2 T C 15: 34,428,785 V765A probably damaging Het
Mptx2 T A 1: 173,274,473 K216N probably damaging Het
Mup5 C T 4: 61,832,341 probably null Het
Mycbp2 A G 14: 103,182,419 Y2494H probably damaging Het
Myh3 G A 11: 67,099,394 D1622N probably benign Het
Myo6 T C 9: 80,270,049 I609T possibly damaging Het
Ndst1 G A 18: 60,702,837 T458I probably damaging Het
Neb A T 2: 52,235,677 Y3622N probably damaging Het
Ntm A G 9: 29,179,100 Y108H probably benign Het
Olfr273 T G 4: 52,855,730 K261T probably benign Het
Olfr43 T C 11: 74,206,572 I215V probably benign Het
Olfr596 T C 7: 103,310,242 Y174H possibly damaging Het
Pappa2 T A 1: 158,814,368 I1373F possibly damaging Het
Phc3 C T 3: 30,961,820 A81T probably damaging Het
Pmepa1 A G 2: 173,234,360 S105P probably damaging Het
Ppp6r1 T C 7: 4,642,031 I248V probably benign Het
Prdm4 G A 10: 85,893,392 T717I probably damaging Het
Prom1 T C 5: 44,011,224 T669A probably benign Het
Ptpn5 T A 7: 47,090,768 I96F probably benign Het
Ptpro T C 6: 137,430,743 L922P probably damaging Het
Reck A T 4: 43,890,982 H40L probably benign Het
Rreb1 T A 13: 37,930,923 C753S probably benign Het
Sacs T C 14: 61,210,897 L3464P probably damaging Het
Samsn1 A T 16: 75,870,775 D304E probably benign Het
Scgb2b3 T C 7: 31,360,196 N51S possibly damaging Het
Shroom3 T C 5: 92,940,656 S341P probably damaging Het
Siglece T C 7: 43,659,293 D212G probably damaging Het
Sirpa A G 2: 129,616,456 T331A probably damaging Het
Spata21 T C 4: 141,111,296 S553P possibly damaging Het
Speer4b T A 5: 27,500,238 probably benign Het
Srgap2 T C 1: 131,319,638 D552G probably damaging Het
Stab2 A G 10: 86,954,234 I556T probably benign Het
Strip1 C T 3: 107,626,731 probably null Het
Stxbp6 T A 12: 44,902,870 D92V probably damaging Het
Styx A G 14: 45,356,758 K46E probably damaging Het
Supt20 T A 3: 54,710,420 V314E probably damaging Het
Syne2 T A 12: 75,938,729 D1650E probably benign Het
Szt2 T A 4: 118,405,517 K21M probably damaging Het
Tbx4 A T 11: 85,911,207 H222L probably damaging Het
Tmx3 A T 18: 90,532,997 I254L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpv2 A T 11: 62,594,226 probably benign Het
Ubap2 A G 4: 41,202,380 S683P probably benign Het
Ube2d3 C T 3: 135,465,211 R139W probably benign Het
Ubox5 G T 2: 130,591,874 Q518K probably benign Het
Usp42 T C 5: 143,717,102 N588S probably damaging Het
Vars2 G A 17: 35,660,084 T618M probably damaging Het
Wfdc17 A T 11: 83,704,904 N65Y probably damaging Het
Zbtb38 G A 9: 96,688,041 P330L probably damaging Het
Zfp385a C T 15: 103,315,881 probably null Het
Zfp637 T A 6: 117,845,412 L167H probably damaging Het
Other mutations in Pear1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Pear1 APN 3 87752116 missense possibly damaging 0.65
IGL01810:Pear1 APN 3 87752301 missense probably damaging 0.98
IGL02269:Pear1 APN 3 87756264 missense probably damaging 1.00
IGL02635:Pear1 APN 3 87750146 makesense probably null
R0040:Pear1 UTSW 3 87754358 missense probably damaging 0.99
R0040:Pear1 UTSW 3 87754358 missense probably damaging 0.99
R0050:Pear1 UTSW 3 87755987 nonsense probably null
R0050:Pear1 UTSW 3 87755987 nonsense probably null
R0090:Pear1 UTSW 3 87754342 missense possibly damaging 0.82
R0547:Pear1 UTSW 3 87788800 intron probably null
R1024:Pear1 UTSW 3 87760299 unclassified probably benign
R1612:Pear1 UTSW 3 87751853 critical splice donor site probably null
R1637:Pear1 UTSW 3 87756753 missense probably damaging 0.97
R1888:Pear1 UTSW 3 87810575 splice site probably benign
R2129:Pear1 UTSW 3 87758359 nonsense probably null
R2255:Pear1 UTSW 3 87752186 missense probably damaging 1.00
R3551:Pear1 UTSW 3 87758132 missense probably benign
R3855:Pear1 UTSW 3 87751921 missense possibly damaging 0.94
R4021:Pear1 UTSW 3 87756222 missense possibly damaging 0.89
R4546:Pear1 UTSW 3 87754661 missense probably damaging 1.00
R5364:Pear1 UTSW 3 87758361 missense probably damaging 1.00
R5447:Pear1 UTSW 3 87759142 missense probably damaging 1.00
R5504:Pear1 UTSW 3 87752695 splice site probably benign
R6026:Pear1 UTSW 3 87756913 missense probably damaging 1.00
R6061:Pear1 UTSW 3 87755931 missense probably benign 0.02
R6155:Pear1 UTSW 3 87759568 missense probably damaging 0.97
R6175:Pear1 UTSW 3 87752133 missense possibly damaging 0.93
R6339:Pear1 UTSW 3 87752520 missense probably damaging 1.00
R6385:Pear1 UTSW 3 87754199 missense probably benign 0.00
R6715:Pear1 UTSW 3 87759117 missense probably damaging 1.00
R6929:Pear1 UTSW 3 87759565 nonsense probably null
R7088:Pear1 UTSW 3 87754638 missense possibly damaging 0.80
R7097:Pear1 UTSW 3 87751445 missense probably benign 0.00
R7229:Pear1 UTSW 3 87750289 missense probably benign 0.00
R7334:Pear1 UTSW 3 87750225 missense probably damaging 1.00
R7526:Pear1 UTSW 3 87752568 missense probably damaging 0.99
X0063:Pear1 UTSW 3 87754072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACAACCAAGGGTCATCTCCTG -3'
(R):5'- GCTCACAGAGTGTACCTGCTTACC -3'

Sequencing Primer
(F):5'- GGCCTAGACAGCCTGGAATAC -3'
(R):5'- TACCCTCCTCAGGTTGGCAG -3'
Posted On2014-05-23