Incidental Mutation 'R7229:Pear1'
ID562336
Institutional Source Beutler Lab
Gene Symbol Pear1
Ensembl Gene ENSMUSG00000028073
Gene Nameplatelet endothelial aggregation receptor 1
SynonymsJedi-1, 3110045G13Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001032413.1, NM_001032414.1, NM_028460.2, NM_152799.2; MGI:1920432

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7229 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location87747890-87824306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87750289 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 988 (S988P)
Ref Sequence ENSEMBL: ENSMUSP00000133474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023846] [ENSMUST00000029714] [ENSMUST00000079083] [ENSMUST00000090981] [ENSMUST00000172621] [ENSMUST00000174219] [ENSMUST00000174267] [ENSMUST00000174713] [ENSMUST00000174759]
Predicted Effect probably benign
Transcript: ENSMUST00000023846
SMART Domains Protein: ENSMUSP00000023846
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:LRR 165 191 6e-7 BLAST
LRR 219 246 4.24e-1 SMART
LRR 251 278 1.33e-1 SMART
LRR 279 306 1.98e-4 SMART
low complexity region 312 323 N/A INTRINSIC
low complexity region 329 337 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 407 414 N/A INTRINSIC
LRR 472 499 1.83e2 SMART
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029714
AA Change: S988P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073
AA Change: S988P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079083
AA Change: S988P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078090
Gene: ENSMUSG00000028073
AA Change: S988P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
AA Change: S988P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073
AA Change: S988P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172621
AA Change: S988P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133474
Gene: ENSMUSG00000028073
AA Change: S988P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172669
SMART Domains Protein: ENSMUSP00000134451
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
EGF_like 1 34 1.85e0 SMART
EGF 33 65 3.1e-2 SMART
EGF 76 108 2.53e1 SMART
transmembrane domain 128 150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174219
SMART Domains Protein: ENSMUSP00000133565
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
EGF 15 47 4.03e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174267
SMART Domains Protein: ENSMUSP00000133626
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174713
SMART Domains Protein: ENSMUSP00000134215
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174759
AA Change: S988P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133323
Gene: ENSMUSG00000028073
AA Change: S988P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PEAR1 is a platelet receptor that signals upon the formation of platelet-platelet contacts independent of platelet activation and secondary to platelet aggregation (Nanda et al., 2005 [PubMed 15851471]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show no apparent defects in hemostasis or thrombus formation. Although in vitro dextran sulfate-induced platelet aggregation is impaired, platelet aggregation initiated with physiological agonists is normal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,595,352 E122G probably benign Het
Adamts2 T C 11: 50,791,820 Y880H probably damaging Het
Atp13a4 A G 16: 29,420,905 S830P probably benign Het
Atp1a3 T A 7: 24,987,985 Q696L probably benign Het
Brox G A 1: 183,291,959 R85* probably null Het
C130073F10Rik T C 4: 101,890,242 I197V probably benign Het
Cand2 G A 6: 115,791,192 V433M probably damaging Het
Cep83 A G 10: 94,719,665 K74E probably damaging Het
Chrng A T 1: 87,209,444 T275S probably benign Het
Clca2 T C 3: 145,084,108 D489G probably damaging Het
Cmtr1 A G 17: 29,695,424 probably null Het
Cnga1 T C 5: 72,618,249 N43S probably benign Het
Cog8 A T 8: 107,056,352 C102S probably damaging Het
Cpsf3 G A 12: 21,296,737 probably null Het
Cyp26b1 G A 6: 84,577,150 Q162* probably null Het
Elmod3 A G 6: 72,594,753 F14S probably benign Het
Eps8 A G 6: 137,539,356 S9P probably benign Het
Fam105a G A 15: 27,658,187 T199M probably benign Het
Fam184b T C 5: 45,584,175 Q238R probably damaging Het
Fbxw7 T C 3: 84,977,369 L654S unknown Het
Foxp1 A T 6: 98,935,412 L580Q unknown Het
Galr1 A G 18: 82,405,664 S163P probably damaging Het
Ganc T C 2: 120,427,775 F201L possibly damaging Het
Gin1 T C 1: 97,785,151 F310L probably benign Het
Grik2 A T 10: 49,101,416 probably null Het
Haus1 A T 18: 77,764,134 F94I probably benign Het
Hcn4 A G 9: 58,853,399 Y409C unknown Het
Hspa1l A G 17: 34,977,255 K90R probably benign Het
Icam5 T C 9: 21,037,001 S702P possibly damaging Het
Ifnar1 A G 16: 91,499,556 H315R probably benign Het
Klra9 T C 6: 130,191,261 H14R probably damaging Het
Krt78 A G 15: 101,947,394 Y661H probably benign Het
Krtap11-1 T C 16: 89,570,925 T69A possibly damaging Het
L3mbtl3 C A 10: 26,292,662 S598I unknown Het
Lama1 A T 17: 67,752,446 D608V Het
Lrrc55 G A 2: 85,196,440 T80I probably damaging Het
Lyst A T 13: 13,643,509 T1255S probably benign Het
Magi2 T C 5: 20,465,588 V310A probably damaging Het
Med23 C A 10: 24,902,004 A750D probably benign Het
Mmp2 G A 8: 92,831,786 R161Q probably damaging Het
Myo15 A T 11: 60,496,495 I733F probably benign Het
Ncan A T 8: 70,100,311 F1090L possibly damaging Het
Olfr701 T G 7: 106,818,995 V304G probably damaging Het
Pafah1b1 A G 11: 74,682,278 I320T probably damaging Het
Pcdhb1 T A 18: 37,266,687 Y564N probably damaging Het
Pgam2 A C 11: 5,803,013 V194G probably damaging Het
Plvap A T 8: 71,511,577 I47N probably damaging Het
Prdx6 A T 1: 161,247,297 L71H probably damaging Het
Psmb11 G A 14: 54,625,951 V209M probably damaging Het
Ptprn2 G A 12: 117,227,225 probably null Het
Rcn2 T A 9: 56,057,479 N240K probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Slc12a4 T G 8: 105,946,737 Q734P probably benign Het
Smarcc2 T A 10: 128,488,048 M1085K unknown Het
Smg1 A T 7: 118,176,955 C1371S probably benign Het
Spg11 A T 2: 122,108,104 F456L probably damaging Het
Srsf10 C T 4: 135,856,217 probably benign Het
Stxbp5 T C 10: 9,798,187 Y4C probably damaging Het
Tdrd12 T A 7: 35,480,280 D881V unknown Het
Tmem171 T C 13: 98,692,625 T6A probably benign Het
Tmem220 T C 11: 67,026,163 L55P unknown Het
Ttn G T 2: 76,846,781 P11037Q unknown Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp47 T C 7: 112,092,877 S849P probably benign Het
Vcan G A 13: 89,705,270 P524S possibly damaging Het
Vmn1r18 A G 6: 57,390,098 M157T probably benign Het
Vmn2r109 A T 17: 20,540,963 C711S possibly damaging Het
Wasf3 C T 5: 146,455,653 R178C probably damaging Het
Wdr76 G A 2: 121,528,920 V231I probably damaging Het
Xirp2 A T 2: 67,525,551 N3552I probably damaging Het
Zfp804a A G 2: 82,258,625 T933A probably benign Het
Zmynd8 A G 2: 165,858,053 probably null Het
Zranb3 A T 1: 128,040,893 I95K probably benign Het
Other mutations in Pear1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Pear1 APN 3 87752116 missense possibly damaging 0.65
IGL01810:Pear1 APN 3 87752301 missense probably damaging 0.98
IGL02269:Pear1 APN 3 87756264 missense probably damaging 1.00
IGL02635:Pear1 APN 3 87750146 makesense probably null
R0040:Pear1 UTSW 3 87754358 missense probably damaging 0.99
R0040:Pear1 UTSW 3 87754358 missense probably damaging 0.99
R0050:Pear1 UTSW 3 87755987 nonsense probably null
R0050:Pear1 UTSW 3 87755987 nonsense probably null
R0090:Pear1 UTSW 3 87754342 missense possibly damaging 0.82
R0547:Pear1 UTSW 3 87788800 intron probably null
R1024:Pear1 UTSW 3 87760299 unclassified probably benign
R1612:Pear1 UTSW 3 87751853 critical splice donor site probably null
R1637:Pear1 UTSW 3 87756753 missense probably damaging 0.97
R1772:Pear1 UTSW 3 87754492 unclassified probably benign
R1888:Pear1 UTSW 3 87810575 splice site probably benign
R2129:Pear1 UTSW 3 87758359 nonsense probably null
R2255:Pear1 UTSW 3 87752186 missense probably damaging 1.00
R3551:Pear1 UTSW 3 87758132 missense probably benign
R3855:Pear1 UTSW 3 87751921 missense possibly damaging 0.94
R4021:Pear1 UTSW 3 87756222 missense possibly damaging 0.89
R4546:Pear1 UTSW 3 87754661 missense probably damaging 1.00
R5364:Pear1 UTSW 3 87758361 missense probably damaging 1.00
R5447:Pear1 UTSW 3 87759142 missense probably damaging 1.00
R5504:Pear1 UTSW 3 87752695 splice site probably benign
R6026:Pear1 UTSW 3 87756913 missense probably damaging 1.00
R6061:Pear1 UTSW 3 87755931 missense probably benign 0.02
R6155:Pear1 UTSW 3 87759568 missense probably damaging 0.97
R6175:Pear1 UTSW 3 87752133 missense possibly damaging 0.93
R6339:Pear1 UTSW 3 87752520 missense probably damaging 1.00
R6385:Pear1 UTSW 3 87754199 missense probably benign 0.00
R6715:Pear1 UTSW 3 87759117 missense probably damaging 1.00
R6929:Pear1 UTSW 3 87759565 nonsense probably null
R7088:Pear1 UTSW 3 87754638 missense possibly damaging 0.80
R7097:Pear1 UTSW 3 87751445 missense probably benign 0.00
R7334:Pear1 UTSW 3 87750225 missense probably damaging 1.00
R7526:Pear1 UTSW 3 87752568 missense probably damaging 0.99
X0063:Pear1 UTSW 3 87754072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAAGTGTTTCTGTTCGTG -3'
(R):5'- TAGTTGAGCAGAGGGCCTTG -3'

Sequencing Primer
(F):5'- TCCTGGCAGGGTACATAGG -3'
(R):5'- GCCTAGTCATACATCCTGGTG -3'
Posted On2019-06-26