Incidental Mutation 'R1772:Clcn1'
ID196691
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Namechloride channel, voltage-sensitive 1
SynonymsClc1, SMCC1, nmf355, NMF355, Clc-1
MMRRC Submission 039803-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1772 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42286685-42315756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42294145 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 281 (T281K)
Ref Sequence ENSEMBL: ENSMUSP00000031894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
Predicted Effect probably damaging
Transcript: ENSMUST00000031894
AA Change: T281K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: T281K

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114684
SMART Domains Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
Pfam:Voltage_CLC 3 254 2.6e-42 PFAM
CBS 294 344 1.3e1 SMART
low complexity region 405 429 N/A INTRINSIC
Blast:CBS 480 524 2e-13 BLAST
low complexity region 575 597 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163936
AA Change: T251K
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: T251K

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168660
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169024
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170028
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,432 S1937P probably damaging Het
Adgb G T 10: 10,382,721 probably benign Het
Aldh1a7 T C 19: 20,716,019 K179E probably damaging Het
Angptl7 G A 4: 148,497,426 R168C probably damaging Het
Atp8b1 T A 18: 64,573,492 I208F possibly damaging Het
Bco1 A G 8: 117,130,608 Y438C probably benign Het
Btrc A C 19: 45,512,661 K218Q probably damaging Het
Cct8l1 G A 5: 25,517,699 V471M probably damaging Het
Cd180 C T 13: 102,706,242 L599F probably benign Het
Cd300e T C 11: 115,054,518 N150S probably benign Het
Cnnm3 T C 1: 36,518,957 S417P probably damaging Het
Cspg4 T A 9: 56,897,492 S1862R probably benign Het
Cspg5 A T 9: 110,262,138 N432Y probably damaging Het
Cyp2r1 T A 7: 114,553,216 I169F probably damaging Het
D130043K22Rik T A 13: 24,875,999 S618T probably damaging Het
Diaph3 G A 14: 86,965,549 P635L probably damaging Het
Dlg1 A G 16: 31,665,667 I38V possibly damaging Het
Dlk1 T G 12: 109,459,759 V186G probably damaging Het
Dmxl2 T C 9: 54,423,224 probably benign Het
Dnajc17 G A 2: 119,183,683 R132* probably null Het
Dock9 G T 14: 121,609,798 N1042K probably benign Het
Dok7 A T 5: 35,086,650 Q511L probably damaging Het
Espnl G A 1: 91,344,603 E562K possibly damaging Het
Evi5 G A 5: 107,795,841 T562I probably benign Het
Exd2 T A 12: 80,489,479 D294E probably benign Het
Fbn1 A T 2: 125,403,228 D246E possibly damaging Het
Fbxw16 A T 9: 109,439,582 W247R possibly damaging Het
Fcer1a A G 1: 173,225,437 I64T probably benign Het
Fcgbp C A 7: 28,105,175 Q1903K possibly damaging Het
Fmn1 A G 2: 113,365,355 S467G unknown Het
Fndc7 T A 3: 108,870,534 T369S probably damaging Het
Fnta T C 8: 26,000,966 probably benign Het
Gak A T 5: 108,606,892 H289Q probably damaging Het
Gas2l3 A G 10: 89,417,014 probably benign Het
Gbp8 T C 5: 105,016,121 N437S probably benign Het
Gk5 G A 9: 96,150,797 probably null Het
Gm21818 T A 13: 120,173,189 D2E probably benign Het
Hid1 A T 11: 115,348,473 V788E probably damaging Het
Hmcn1 T C 1: 150,563,568 T5505A probably damaging Het
Igf1r T A 7: 68,195,074 M865K probably benign Het
Katnal2 G A 18: 77,002,537 T258I probably damaging Het
Kdm3b A T 18: 34,803,504 I280L probably benign Het
Kif24 A G 4: 41,409,787 V382A probably damaging Het
Kif2a A T 13: 106,978,132 probably benign Het
Klhl10 A G 11: 100,442,196 I56V probably benign Het
Klk6 C T 7: 43,829,271 Q201* probably null Het
Klra3 A T 6: 130,323,708 S233T probably benign Het
Krt9 A T 11: 100,191,305 M223K probably damaging Het
Lama4 G A 10: 39,060,224 E632K probably benign Het
Lamb1 T C 12: 31,278,525 Y163H probably damaging Het
Lipo1 A G 19: 33,787,421 I11T probably benign Het
Lix1l T A 3: 96,623,891 H333Q possibly damaging Het
Mal2 T A 15: 54,588,387 M68K probably damaging Het
Map2k2 T C 10: 81,121,100 I104T probably damaging Het
Matn2 T C 15: 34,428,785 V765A probably damaging Het
Mptx2 T A 1: 173,274,473 K216N probably damaging Het
Mup5 C T 4: 61,832,341 probably null Het
Mycbp2 A G 14: 103,182,419 Y2494H probably damaging Het
Myh3 G A 11: 67,099,394 D1622N probably benign Het
Myo6 T C 9: 80,270,049 I609T possibly damaging Het
Ndst1 G A 18: 60,702,837 T458I probably damaging Het
Neb A T 2: 52,235,677 Y3622N probably damaging Het
Ntm A G 9: 29,179,100 Y108H probably benign Het
Olfr273 T G 4: 52,855,730 K261T probably benign Het
Olfr43 T C 11: 74,206,572 I215V probably benign Het
Olfr596 T C 7: 103,310,242 Y174H possibly damaging Het
Pappa2 T A 1: 158,814,368 I1373F possibly damaging Het
Pear1 A G 3: 87,754,492 probably benign Het
Phc3 C T 3: 30,961,820 A81T probably damaging Het
Pmepa1 A G 2: 173,234,360 S105P probably damaging Het
Ppp6r1 T C 7: 4,642,031 I248V probably benign Het
Prdm4 G A 10: 85,893,392 T717I probably damaging Het
Prom1 T C 5: 44,011,224 T669A probably benign Het
Ptpn5 T A 7: 47,090,768 I96F probably benign Het
Ptpro T C 6: 137,430,743 L922P probably damaging Het
Reck A T 4: 43,890,982 H40L probably benign Het
Rreb1 T A 13: 37,930,923 C753S probably benign Het
Sacs T C 14: 61,210,897 L3464P probably damaging Het
Samsn1 A T 16: 75,870,775 D304E probably benign Het
Scgb2b3 T C 7: 31,360,196 N51S possibly damaging Het
Shroom3 T C 5: 92,940,656 S341P probably damaging Het
Siglece T C 7: 43,659,293 D212G probably damaging Het
Sirpa A G 2: 129,616,456 T331A probably damaging Het
Spata21 T C 4: 141,111,296 S553P possibly damaging Het
Speer4b T A 5: 27,500,238 probably benign Het
Srgap2 T C 1: 131,319,638 D552G probably damaging Het
Stab2 A G 10: 86,954,234 I556T probably benign Het
Strip1 C T 3: 107,626,731 probably null Het
Stxbp6 T A 12: 44,902,870 D92V probably damaging Het
Styx A G 14: 45,356,758 K46E probably damaging Het
Supt20 T A 3: 54,710,420 V314E probably damaging Het
Syne2 T A 12: 75,938,729 D1650E probably benign Het
Szt2 T A 4: 118,405,517 K21M probably damaging Het
Tbx4 A T 11: 85,911,207 H222L probably damaging Het
Tmx3 A T 18: 90,532,997 I254L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpv2 A T 11: 62,594,226 probably benign Het
Ubap2 A G 4: 41,202,380 S683P probably benign Het
Ube2d3 C T 3: 135,465,211 R139W probably benign Het
Ubox5 G T 2: 130,591,874 Q518K probably benign Het
Usp42 T C 5: 143,717,102 N588S probably damaging Het
Vars2 G A 17: 35,660,084 T618M probably damaging Het
Wfdc17 A T 11: 83,704,904 N65Y probably damaging Het
Zbtb38 G A 9: 96,688,041 P330L probably damaging Het
Zfp385a C T 15: 103,315,881 probably null Het
Zfp637 T A 6: 117,845,412 L167H probably damaging Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42291703 missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42310672 splice site probably benign
IGL02055:Clcn1 APN 6 42307555 missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42307073 splice site probably benign
IGL02649:Clcn1 APN 6 42298829 missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42286780 unclassified probably null
IGL03148:Clcn1 APN 6 42299991 critical splice donor site probably null
IGL03190:Clcn1 APN 6 42290103 missense probably benign 0.02
IGL03327:Clcn1 APN 6 42311219 missense probably benign 0.00
IGL03346:Clcn1 APN 6 42311219 missense probably benign 0.00
maimed UTSW 6 42298820 missense probably damaging 1.00
R0167:Clcn1 UTSW 6 42286836 missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42310140 missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42310581 missense probably benign
R0573:Clcn1 UTSW 6 42313045 splice site probably null
R0615:Clcn1 UTSW 6 42305575 missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42313141 missense probably benign 0.00
R1562:Clcn1 UTSW 6 42300235 missense probably benign 0.29
R1566:Clcn1 UTSW 6 42291440 missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42313098 missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1784:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42298926 critical splice donor site probably null
R1861:Clcn1 UTSW 6 42313991 missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42291625 missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42313112 missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42298850 missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42290178 missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42292995 missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42309968 missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42290197 splice site probably null
R4836:Clcn1 UTSW 6 42309964 missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42310988 nonsense probably null
R5085:Clcn1 UTSW 6 42313880 missense probably benign 0.41
R5528:Clcn1 UTSW 6 42300341 missense probably benign 0.01
R5628:Clcn1 UTSW 6 42298889 missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42307265 missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42292966 missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42300274 nonsense probably null
R6175:Clcn1 UTSW 6 42314162 missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42307590 missense possibly damaging 0.84
R6394:Clcn1 UTSW 6 42313238 missense possibly damaging 0.82
R7012:Clcn1 UTSW 6 42290608 missense probably benign 0.01
R7020:Clcn1 UTSW 6 42298820 missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42307543 missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42291389 missense possibly damaging 0.46
R7225:Clcn1 UTSW 6 42293462 missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42298838 missense probably damaging 1.00
Z1088:Clcn1 UTSW 6 42300360 missense probably benign 0.40
Z1088:Clcn1 UTSW 6 42307256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAAGTCTTGCCACCTCTTGCTAC -3'
(R):5'- GATGTCAATATGCCCCTGCTCCAG -3'

Sequencing Primer
(F):5'- GCTCATAAAGTCACTTCCTGATTG -3'
(R):5'- ATGATGCTCTACTGAACTGCAC -3'
Posted On2014-05-23