Incidental Mutation 'R1777:Robo1'
ID197170
Institutional Source Beutler Lab
Gene Symbol Robo1
Ensembl Gene ENSMUSG00000022883
Gene Nameroundabout guidance receptor 1
SynonymsDUTT1
MMRRC Submission 039808-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1777 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location72308306-73046095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 73004667 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 1060 (W1060G)
Ref Sequence ENSEMBL: ENSMUSP00000023600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023600]
Predicted Effect probably benign
Transcript: ENSMUST00000023600
AA Change: W1060G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023600
Gene: ENSMUSG00000022883
AA Change: W1060G

DomainStartEndE-ValueType
IGc2 41 115 3.15e-10 SMART
IGc2 143 208 2.52e-9 SMART
IGc2 235 298 3.85e-14 SMART
IGv 328 391 3.71e-7 SMART
IGc2 428 493 2.46e-12 SMART
FN3 522 604 3.17e-13 SMART
FN3 634 721 1.66e0 SMART
FN3 736 822 4.28e-10 SMART
low complexity region 1108 1125 N/A INTRINSIC
low complexity region 1148 1157 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1249 1269 N/A INTRINSIC
low complexity region 1282 1298 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
low complexity region 1362 1380 N/A INTRINSIC
low complexity region 1442 1449 N/A INTRINSIC
low complexity region 1563 1576 N/A INTRINSIC
low complexity region 1602 1611 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000232205
AA Change: W1069G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232432
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a reporter allele show altered axon guidance. Mice homozygous for a null allele die at birth showing aberrant axon pathfinding and cortical interneuron migration. Homozygotes for another null allele show neonatal death, aphagia, delayed lung maturation and bronchial hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T A 1: 16,078,589 D111V possibly damaging Het
Ap2a1 G A 7: 44,904,152 T597M probably damaging Het
Arhgap25 A G 6: 87,463,307 S364P probably benign Het
Atp6v1a G T 16: 44,114,705 Y40* probably null Het
Cdh1 T A 8: 106,656,835 H235Q probably damaging Het
Cntln A G 4: 85,130,679 E1376G probably benign Het
Cntnap5b T A 1: 100,370,078 S781T probably benign Het
Cpne4 A G 9: 104,872,688 T64A probably damaging Het
Ctsg T C 14: 56,100,601 Y179C probably damaging Het
Cx3cr1 A G 9: 120,051,593 Y248H probably damaging Het
Dhx37 T C 5: 125,429,931 E167G probably benign Het
Dnajc21 C A 15: 10,449,607 A443S probably benign Het
Drd5 T C 5: 38,320,161 S166P probably damaging Het
Dscaml1 T C 9: 45,683,756 L719P possibly damaging Het
Eif2ak4 T C 2: 118,430,839 I542T probably damaging Het
Ephb3 G A 16: 21,217,235 G291E probably damaging Het
Eva1a T A 6: 82,092,156 Y155N probably damaging Het
Exog C T 9: 119,449,818 P189L probably damaging Het
Fam13b A G 18: 34,457,760 V455A possibly damaging Het
Fam192a T C 8: 94,588,811 E31G probably damaging Het
Fam35a C A 14: 34,268,173 V259L probably benign Het
Fmn2 C A 1: 174,581,922 Q574K unknown Het
Gm10037 A T 13: 67,833,865 R65S probably benign Het
Gm6871 A T 7: 41,545,719 S531R probably benign Het
Golga2 T A 2: 32,305,470 probably null Het
Hydin C T 8: 110,589,571 P4365L probably benign Het
Ints8 A T 4: 11,225,600 probably null Het
Kbtbd12 A C 6: 88,618,060 S263A probably benign Het
Kcng4 T C 8: 119,633,487 D50G probably benign Het
Klhl18 A T 9: 110,437,401 C217S probably benign Het
Klk1b4 A G 7: 44,207,451 probably benign Het
Klk7 G A 7: 43,813,329 C186Y probably damaging Het
Krit1 T C 5: 3,836,799 Y635H probably damaging Het
Lipo4 A T 19: 33,499,321 D342E probably damaging Het
Lsm14b T G 2: 180,031,795 D199E probably benign Het
Map3k4 A T 17: 12,271,730 N271K possibly damaging Het
Mast1 T A 8: 84,912,068 N1544I probably benign Het
Megf6 T A 4: 154,270,690 C1487* probably null Het
Mlh3 C A 12: 85,268,754 K219N possibly damaging Het
Mtmr4 A G 11: 87,602,830 K305E probably damaging Het
Myo15 A G 11: 60,514,936 M3105V probably benign Het
Nbas A T 12: 13,513,562 I1958F probably benign Het
Nepro A T 16: 44,735,853 Q458L probably damaging Het
Olfr1309 T A 2: 111,983,697 I126L possibly damaging Het
Olfr198 A G 16: 59,202,016 S137P probably benign Het
Olfr295 T A 7: 86,586,064 I263N probably benign Het
Olfr583 T C 7: 103,051,376 I26T probably benign Het
Olfr741 T A 14: 50,486,300 F281I probably benign Het
Olfr874 A G 9: 37,746,311 Y59C possibly damaging Het
Opa3 T C 7: 19,244,912 Y101H probably damaging Het
Pate3 T C 9: 35,648,116 N2D probably benign Het
Pcdhb21 T A 18: 37,515,718 D633E possibly damaging Het
Pgm1 C T 5: 64,127,782 P589L probably benign Het
Pigg T A 5: 108,317,391 D163E probably damaging Het
Polq A G 16: 37,060,224 T638A possibly damaging Het
Prmt3 T A 7: 49,798,346 M268K possibly damaging Het
Prmt9 T C 8: 77,565,108 C370R probably benign Het
Prss57 A T 10: 79,787,385 V76E possibly damaging Het
Pzp T C 6: 128,490,572 E1089G possibly damaging Het
Qars T A 9: 108,508,201 probably null Het
Ralgapb T C 2: 158,462,195 Y625H probably damaging Het
Rgl2 G A 17: 33,931,744 D59N probably benign Het
Scaper A T 9: 55,864,546 V362E probably benign Het
Schip1 T C 3: 68,617,684 F131S probably damaging Het
Sh2b2 A T 5: 136,227,422 V252D probably damaging Het
Slc17a6 A T 7: 51,646,209 H199L possibly damaging Het
Slc29a1 A G 17: 45,587,308 Y325H probably damaging Het
Slc29a4 G T 5: 142,714,062 W156L probably damaging Het
Slc5a3 T A 16: 92,077,756 S234T probably benign Het
Srd5a3 T G 5: 76,149,783 V20G probably damaging Het
Stac A T 9: 111,604,082 S223T possibly damaging Het
Sytl2 A T 7: 90,403,052 T766S probably benign Het
Tas2r102 A G 6: 132,762,291 D54G probably benign Het
Tbpl1 A G 10: 22,707,843 V105A probably damaging Het
Tenm3 G T 8: 48,417,179 P193Q probably benign Het
Tes G A 6: 17,104,755 V403M probably benign Het
Tgfbr2 A C 9: 116,109,880 I318S probably damaging Het
Tgfbr3 C A 5: 107,136,930 V618L probably benign Het
Tmc1 C T 19: 20,816,109 probably null Het
Tmem132a G A 19: 10,858,506 H887Y probably damaging Het
Tmem43 C A 6: 91,477,330 S33* probably null Het
Tob1 A G 11: 94,213,754 K39E probably damaging Het
Unc79 T A 12: 103,112,455 D1433E probably damaging Het
Usp25 T C 16: 77,081,554 M622T probably damaging Het
Vmn1r158 A T 7: 22,790,430 L118Q probably damaging Het
Vmn1r217 T A 13: 23,114,325 I136L probably benign Het
Vmn2r15 A T 5: 109,294,270 I99K possibly damaging Het
Vwa7 T A 17: 35,024,948 V786E probably damaging Het
Xkr5 A G 8: 18,939,132 F248S probably benign Het
Zcchc6 A T 13: 59,791,821 H705Q probably damaging Het
Zzef1 A T 11: 72,910,272 K2444M probably damaging Het
Other mutations in Robo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Robo1 APN 16 73004665 missense probably benign 0.00
IGL01937:Robo1 APN 16 72962226 missense probably damaging 1.00
IGL01945:Robo1 APN 16 72962226 missense probably damaging 1.00
IGL02151:Robo1 APN 16 72989616 missense probably benign 0.00
IGL02232:Robo1 APN 16 72971984 missense possibly damaging 0.59
IGL02282:Robo1 APN 16 72742138 missense probably damaging 1.00
IGL02590:Robo1 APN 16 73043132 missense probably benign 0.06
IGL02874:Robo1 APN 16 73012918 missense probably damaging 0.96
IGL02974:Robo1 APN 16 73006862 missense probably benign 0.09
IGL03233:Robo1 APN 16 72970193 missense probably damaging 0.99
PIT4378001:Robo1 UTSW 16 73004535 missense probably damaging 1.00
R0079:Robo1 UTSW 16 72933342 splice site probably benign
R0254:Robo1 UTSW 16 72664170 missense probably benign 0.00
R0366:Robo1 UTSW 16 72742245 missense possibly damaging 0.52
R0410:Robo1 UTSW 16 72971984 missense possibly damaging 0.59
R0511:Robo1 UTSW 16 73013125 critical splice donor site probably null
R0563:Robo1 UTSW 16 72972286 missense probably benign 0.01
R0637:Robo1 UTSW 16 73001951 missense probably benign 0.29
R1239:Robo1 UTSW 16 73024542 splice site probably null
R1773:Robo1 UTSW 16 73004511 missense probably benign 0.00
R1901:Robo1 UTSW 16 72960204 missense probably null 1.00
R1902:Robo1 UTSW 16 72960204 missense probably null 1.00
R1903:Robo1 UTSW 16 72960204 missense probably null 1.00
R1996:Robo1 UTSW 16 72970179 missense probably benign 0.40
R2040:Robo1 UTSW 16 72933742 missense probably damaging 1.00
R2266:Robo1 UTSW 16 72978772 missense probably benign
R2269:Robo1 UTSW 16 72978772 missense probably benign
R2433:Robo1 UTSW 16 72970239 missense probably benign 0.01
R3084:Robo1 UTSW 16 73004737 missense probably benign 0.02
R3085:Robo1 UTSW 16 73002010 missense possibly damaging 0.81
R3150:Robo1 UTSW 16 72970269 missense possibly damaging 0.57
R3418:Robo1 UTSW 16 73035917 missense probably benign 0.00
R3610:Robo1 UTSW 16 72983770 missense probably benign 0.00
R3940:Robo1 UTSW 16 73009743 missense probably benign
R3953:Robo1 UTSW 16 73024338 missense probably damaging 1.00
R4692:Robo1 UTSW 16 72960202 missense probably damaging 1.00
R4726:Robo1 UTSW 16 72972043 missense probably damaging 1.00
R4814:Robo1 UTSW 16 72972035 missense probably benign 0.11
R4884:Robo1 UTSW 16 72904751 missense probably damaging 1.00
R4992:Robo1 UTSW 16 72979868 missense probably damaging 0.98
R5150:Robo1 UTSW 16 72972304 missense possibly damaging 0.79
R5183:Robo1 UTSW 16 72742150 missense probably benign 0.03
R5360:Robo1 UTSW 16 72935777 missense probably damaging 0.96
R5629:Robo1 UTSW 16 72983710 missense probably benign 0.33
R5804:Robo1 UTSW 16 73043189 critical splice donor site probably null
R6107:Robo1 UTSW 16 72983829 missense probably benign 0.00
R6127:Robo1 UTSW 16 73013068 missense probably benign
R6128:Robo1 UTSW 16 73013068 missense probably benign
R6129:Robo1 UTSW 16 73013068 missense probably benign
R6191:Robo1 UTSW 16 72933808 missense probably benign 0.00
R6357:Robo1 UTSW 16 72970302 missense probably benign 0.00
R6408:Robo1 UTSW 16 72972046 missense probably benign 0.00
R6516:Robo1 UTSW 16 73024353 missense probably benign 0.14
R6600:Robo1 UTSW 16 72989655 missense probably damaging 1.00
R6802:Robo1 UTSW 16 72933313 missense probably benign 0.17
R7105:Robo1 UTSW 16 72742161 missense probably damaging 1.00
R7189:Robo1 UTSW 16 72960151 nonsense probably null
R7290:Robo1 UTSW 16 73004520 missense probably benign 0.03
R7296:Robo1 UTSW 16 72989631 nonsense probably null
R7576:Robo1 UTSW 16 72970181 missense probably damaging 0.99
R7605:Robo1 UTSW 16 73024301 missense probably benign 0.14
R7607:Robo1 UTSW 16 72563738 missense
R7636:Robo1 UTSW 16 72563727 missense
Predicted Primers PCR Primer
(F):5'- CGGGATCGTAAATAACGCCGACAG -3'
(R):5'- TGCAGAACACTCAGGGAGATCAGAC -3'

Sequencing Primer
(F):5'- AGCCTGTGTGAATAGTTAACCCC -3'
(R):5'- CTCAGGGAGATCAGACAGGAAG -3'
Posted On2014-05-23