Incidental Mutation 'R5629:Robo1'
ID501350
Institutional Source Beutler Lab
Gene Symbol Robo1
Ensembl Gene ENSMUSG00000022883
Gene Nameroundabout guidance receptor 1
SynonymsDUTT1
MMRRC Submission 043280-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5629 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location72308306-73046095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72983710 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 776 (V776A)
Ref Sequence ENSEMBL: ENSMUSP00000023600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023600]
Predicted Effect probably benign
Transcript: ENSMUST00000023600
AA Change: V776A

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023600
Gene: ENSMUSG00000022883
AA Change: V776A

DomainStartEndE-ValueType
IGc2 41 115 3.15e-10 SMART
IGc2 143 208 2.52e-9 SMART
IGc2 235 298 3.85e-14 SMART
IGv 328 391 3.71e-7 SMART
IGc2 428 493 2.46e-12 SMART
FN3 522 604 3.17e-13 SMART
FN3 634 721 1.66e0 SMART
FN3 736 822 4.28e-10 SMART
low complexity region 1108 1125 N/A INTRINSIC
low complexity region 1148 1157 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1249 1269 N/A INTRINSIC
low complexity region 1282 1298 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
low complexity region 1362 1380 N/A INTRINSIC
low complexity region 1442 1449 N/A INTRINSIC
low complexity region 1563 1576 N/A INTRINSIC
low complexity region 1602 1611 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231566
Predicted Effect unknown
Transcript: ENSMUST00000232205
AA Change: V785A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232545
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a reporter allele show altered axon guidance. Mice homozygous for a null allele die at birth showing aberrant axon pathfinding and cortical interneuron migration. Homozygotes for another null allele show neonatal death, aphagia, delayed lung maturation and bronchial hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 G A 5: 35,857,163 D189N probably benign Het
Adamts9 A T 6: 92,798,133 V1052D probably damaging Het
Apob T C 12: 8,007,847 Y2077H probably damaging Het
Apol7e A T 15: 77,718,076 K291N probably benign Het
Arsk A T 13: 76,093,908 I82N probably damaging Het
Art1 A G 7: 102,107,079 Q159R probably benign Het
Atp2a2 A G 5: 122,460,096 V733A probably damaging Het
Btn2a2 A T 13: 23,481,960 probably null Het
Catsper1 C T 19: 5,336,137 P133S probably benign Het
Celsr3 A G 9: 108,849,067 D3165G probably benign Het
Cldn19 T A 4: 119,256,919 V86E probably damaging Het
Ctnna1 T A 18: 35,249,749 D649E probably benign Het
Cttnbp2 A G 6: 18,405,218 I1094T probably damaging Het
Ddx24 T C 12: 103,425,547 probably benign Het
Ern2 T A 7: 122,170,166 H879L probably damaging Het
Etv4 T A 11: 101,771,925 H277L probably damaging Het
Faap100 G T 11: 120,377,011 A312D probably damaging Het
Glipr1l1 G A 10: 112,078,403 C223Y possibly damaging Het
Gna14 T C 19: 16,436,733 S14P possibly damaging Het
Hapln1 A G 13: 89,601,515 T60A probably damaging Het
Hars2 T A 18: 36,788,666 Y273* probably null Het
Ighv5-6 A T 12: 113,625,622 Y79* probably null Het
Iqgap2 T A 13: 95,632,174 N1406I probably damaging Het
Kalrn T C 16: 34,039,934 T215A possibly damaging Het
Krtap13-1 T A 16: 88,729,159 S90R probably benign Het
Mettl8 T C 2: 70,965,569 I372V probably benign Het
Mfn1 A T 3: 32,561,510 T341S possibly damaging Het
Mocos T A 18: 24,664,085 probably null Het
Muc5b T C 7: 141,861,299 S2661P possibly damaging Het
Myo15 C T 11: 60,479,752 P1113S probably benign Het
Myo5a A T 9: 75,203,845 I1540F possibly damaging Het
Myoc T C 1: 162,648,587 Y287H probably damaging Het
Napepld A G 5: 21,675,903 F165L probably benign Het
Ndufb10 T C 17: 24,722,682 E102G probably damaging Het
Nrros T A 16: 32,144,405 I265F probably damaging Het
Nrxn1 A T 17: 90,590,032 F891I possibly damaging Het
Nsfl1c T C 2: 151,504,165 Y169H probably damaging Het
Oas2 G A 5: 120,738,451 Q476* probably null Het
Olfr561 A T 7: 102,774,640 I39F possibly damaging Het
Pcnx2 C A 8: 125,898,041 W14L probably damaging Het
Piwil2 C T 14: 70,422,967 V70M probably damaging Het
Prss23 A C 7: 89,510,192 V223G probably damaging Het
Rarres2 A T 6: 48,570,260 L122Q probably benign Het
Robo3 G A 9: 37,419,211 Q1008* probably null Het
Robo4 G A 9: 37,408,362 C636Y probably damaging Het
Sacm1l A G 9: 123,566,399 M196V probably benign Het
Sept7 T A 9: 25,288,293 Y163N probably damaging Het
Skint6 G A 4: 113,012,979 T594I possibly damaging Het
Slc23a1 T C 18: 35,626,492 H13R probably benign Het
Slc25a39 A C 11: 102,404,893 Y109* probably null Het
Slc8a3 G A 12: 81,199,631 R883C probably damaging Het
Spag17 A T 3: 100,080,119 Y1575F probably benign Het
Spdye4c T A 2: 128,596,785 I321N probably damaging Het
Stk32b G A 5: 37,457,232 P311S probably damaging Het
Svs3a T A 2: 164,290,120 S203T probably benign Het
Taf3 A T 2: 9,918,178 I45N probably damaging Het
Taf7 T C 18: 37,643,502 N4S probably benign Het
Tial1 T A 7: 128,444,697 D87V probably damaging Het
Tmem120a T A 5: 135,742,050 E78V probably benign Het
Tmem19 A G 10: 115,347,260 F137L probably benign Het
Tmem55b T C 14: 50,927,916 H278R probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trim30d T C 7: 104,487,929 K23E possibly damaging Het
Ubxn7 C A 16: 32,332,299 H4Q unknown Het
Usp40 C T 1: 87,981,009 R590H probably benign Het
Vmn1r90 A G 7: 14,562,086 M22T possibly damaging Het
Vmn2r1 G A 3: 64,105,117 V800M possibly damaging Het
Vps11 A T 9: 44,356,376 I313N probably damaging Het
Zhx1 A G 15: 58,054,811 V13A probably damaging Het
Zic4 G A 9: 91,378,752 R20H probably benign Het
Zp3r C T 1: 130,582,879 V369M probably damaging Het
Other mutations in Robo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Robo1 APN 16 73004665 missense probably benign 0.00
IGL01937:Robo1 APN 16 72962226 missense probably damaging 1.00
IGL01945:Robo1 APN 16 72962226 missense probably damaging 1.00
IGL02151:Robo1 APN 16 72989616 missense probably benign 0.00
IGL02232:Robo1 APN 16 72971984 missense possibly damaging 0.59
IGL02282:Robo1 APN 16 72742138 missense probably damaging 1.00
IGL02590:Robo1 APN 16 73043132 missense probably benign 0.06
IGL02874:Robo1 APN 16 73012918 missense probably damaging 0.96
IGL02974:Robo1 APN 16 73006862 missense probably benign 0.09
IGL03233:Robo1 APN 16 72970193 missense probably damaging 0.99
PIT4378001:Robo1 UTSW 16 73004535 missense probably damaging 1.00
R0079:Robo1 UTSW 16 72933342 splice site probably benign
R0254:Robo1 UTSW 16 72664170 missense probably benign 0.00
R0366:Robo1 UTSW 16 72742245 missense possibly damaging 0.52
R0410:Robo1 UTSW 16 72971984 missense possibly damaging 0.59
R0511:Robo1 UTSW 16 73013125 critical splice donor site probably null
R0563:Robo1 UTSW 16 72972286 missense probably benign 0.01
R0637:Robo1 UTSW 16 73001951 missense probably benign 0.29
R1239:Robo1 UTSW 16 73024542 splice site probably null
R1773:Robo1 UTSW 16 73004511 missense probably benign 0.00
R1777:Robo1 UTSW 16 73004667 missense probably benign
R1901:Robo1 UTSW 16 72960204 missense probably null 1.00
R1902:Robo1 UTSW 16 72960204 missense probably null 1.00
R1903:Robo1 UTSW 16 72960204 missense probably null 1.00
R1996:Robo1 UTSW 16 72970179 missense probably benign 0.40
R2040:Robo1 UTSW 16 72933742 missense probably damaging 1.00
R2266:Robo1 UTSW 16 72978772 missense probably benign
R2269:Robo1 UTSW 16 72978772 missense probably benign
R2433:Robo1 UTSW 16 72970239 missense probably benign 0.01
R3084:Robo1 UTSW 16 73004737 missense probably benign 0.02
R3085:Robo1 UTSW 16 73002010 missense possibly damaging 0.81
R3150:Robo1 UTSW 16 72970269 missense possibly damaging 0.57
R3418:Robo1 UTSW 16 73035917 missense probably benign 0.00
R3610:Robo1 UTSW 16 72983770 missense probably benign 0.00
R3940:Robo1 UTSW 16 73009743 missense probably benign
R3953:Robo1 UTSW 16 73024338 missense probably damaging 1.00
R4692:Robo1 UTSW 16 72960202 missense probably damaging 1.00
R4726:Robo1 UTSW 16 72972043 missense probably damaging 1.00
R4814:Robo1 UTSW 16 72972035 missense probably benign 0.11
R4884:Robo1 UTSW 16 72904751 missense probably damaging 1.00
R4992:Robo1 UTSW 16 72979868 missense probably damaging 0.98
R5150:Robo1 UTSW 16 72972304 missense possibly damaging 0.79
R5183:Robo1 UTSW 16 72742150 missense probably benign 0.03
R5360:Robo1 UTSW 16 72935777 missense probably damaging 0.96
R5804:Robo1 UTSW 16 73043189 critical splice donor site probably null
R6107:Robo1 UTSW 16 72983829 missense probably benign 0.00
R6127:Robo1 UTSW 16 73013068 missense probably benign
R6128:Robo1 UTSW 16 73013068 missense probably benign
R6129:Robo1 UTSW 16 73013068 missense probably benign
R6191:Robo1 UTSW 16 72933808 missense probably benign 0.00
R6357:Robo1 UTSW 16 72970302 missense probably benign 0.00
R6408:Robo1 UTSW 16 72972046 missense probably benign 0.00
R6516:Robo1 UTSW 16 73024353 missense probably benign 0.14
R6600:Robo1 UTSW 16 72989655 missense probably damaging 1.00
R6802:Robo1 UTSW 16 72933313 missense probably benign 0.17
R7105:Robo1 UTSW 16 72742161 missense probably damaging 1.00
R7189:Robo1 UTSW 16 72960151 nonsense probably null
R7290:Robo1 UTSW 16 73004520 missense probably benign 0.03
R7296:Robo1 UTSW 16 72989631 nonsense probably null
R7576:Robo1 UTSW 16 72970181 missense probably damaging 0.99
R7605:Robo1 UTSW 16 73024301 missense probably benign 0.14
R7607:Robo1 UTSW 16 72563738 missense
R7636:Robo1 UTSW 16 72563727 missense
Predicted Primers PCR Primer
(F):5'- CATGAGAGAACATAAGAGCTATTGC -3'
(R):5'- GACAAATCACGTGACGCTTAC -3'

Sequencing Primer
(F):5'- GCTATTGCTGATATTCAACGTGAC -3'
(R):5'- ACGTGACGCTTACCTAACTGGATG -3'
Posted On2017-12-01