Mutagenetix > Incidental Mutations

Incidental Mutation 'R8402:Robo1'

652250

Institutional Source

Beutler Lab

Gene Symbol

Robo1

Ensembl Gene

ENSMUSG00000022883

Gene Name

roundabout guidance receptor 1

Synonyms

DUTT1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8402 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72308306-73046095 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 73024497 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 1375 (A1375E)

Ref Sequence

ENSEMBL: ENSMUSP00000023600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023600]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000023600
AA Change: A1375E

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000023600
Gene: ENSMUSG00000022883
AA Change: A1375E

Domain	Start	End	E-Value	Type
IGc2	41	115	3.15e-10	SMART
IGc2	143	208	2.52e-9	SMART
IGc2	235	298	3.85e-14	SMART
IGv	328	391	3.71e-7	SMART
IGc2	428	493	2.46e-12	SMART
FN3	522	604	3.17e-13	SMART
FN3	634	721	1.66e0	SMART
FN3	736	822	4.28e-10	SMART
low complexity region	1108	1125	N/A	INTRINSIC
low complexity region	1148	1157	N/A	INTRINSIC
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1249	1269	N/A	INTRINSIC
low complexity region	1282	1298	N/A	INTRINSIC
low complexity region	1345	1357	N/A	INTRINSIC
low complexity region	1362	1380	N/A	INTRINSIC
low complexity region	1442	1449	N/A	INTRINSIC
low complexity region	1563	1576	N/A	INTRINSIC
low complexity region	1602	1611	N/A	INTRINSIC

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a reporter allele show altered axon guidance. Mice homozygous for a null allele die at birth showing aberrant axon pathfinding and cortical interneuron migration. Homozygotes for another null allele show neonatal death, aphagia, delayed lung maturation and bronchial hyperplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	A	6: 129,323,044	D157V	possibly damaging	Het
Adamts12	A	T	15: 11,263,290	K579N	probably damaging	Het
Adcy7	T	C	8: 88,308,735	V89A	probably benign	Het
Anapc1	G	A	2: 128,630,228	S1458L	probably benign	Het
AW551984	T	C	9: 39,597,653	Y325C	probably damaging	Het
Btnl4	T	C	17: 34,469,493	Y437C	probably damaging	Het
Ccdc88a	T	A	11: 29,463,879	S806T	probably damaging	Het
Ddit4l	A	G	3: 137,626,127	T85A	probably damaging	Het
Dmxl1	G	A	18: 49,878,326	W1183*	probably null	Het
Dmxl1	G	C	18: 49,878,327	D1184H	probably benign	Het
Dmxl1	G	T	18: 49,878,342	V1189L	probably benign	Het
Evpl	T	C	11: 116,225,371	D820G	probably benign	Het
Fam76b	T	C	9: 13,839,676	S289P	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Gabrb2	T	C	11: 42,487,304	W116R	probably damaging	Het
Galnt7	G	A	8: 57,542,919	A355V	probably damaging	Het
Klk1b5	T	G	7: 44,218,538	F45V	probably benign	Het
Nav2	T	C	7: 49,453,437	V661A	probably benign	Het
Nfkbiz	T	C	16: 55,816,387	N517S	probably damaging	Het
Olfr1330	A	G	4: 118,893,519	I145M	probably benign	Het
Olfr975	T	A	9: 39,950,417	Y118F	probably benign	Het
P2rx1	T	C	11: 73,013,889	F368L	probably damaging	Het
Palld	A	T	8: 61,711,406	V417E	probably damaging	Het
Rps24	G	T	14: 24,490,761		probably benign	Het
Serpind1	A	G	16: 17,337,085	N259D	probably benign	Het
Sh3bp4	C	A	1: 89,145,315	N628K	probably benign	Het
Tada3	A	T	6: 113,374,813	L177Q	probably damaging	Het
Tcam1	T	A	11: 106,286,905	L508Q	probably damaging	Het
Thbs1	T	C	2: 118,115,878	S360P	possibly damaging	Het
Tmem33	T	C	5: 67,267,375		probably benign	Het
Vmn2r3	A	G	3: 64,271,196		probably benign	Het
Vwa3b	A	G	1: 37,165,798	E121G	probably damaging	Het
Zfp607b	T	A	7: 27,702,702	H194Q	probably damaging	Het
Zfp729b	G	A	13: 67,592,577	P523L	probably damaging	Het

Other mutations in Robo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01766:Robo1	APN	16	73004665	missense	probably benign	0.00
IGL01937:Robo1	APN	16	72962226	missense	probably damaging	1.00
IGL01945:Robo1	APN	16	72962226	missense	probably damaging	1.00
IGL02151:Robo1	APN	16	72989616	missense	probably benign	0.00
IGL02232:Robo1	APN	16	72971984	missense	possibly damaging	0.59
IGL02282:Robo1	APN	16	72742138	missense	probably damaging	1.00
IGL02590:Robo1	APN	16	73043132	missense	probably benign	0.06
IGL02874:Robo1	APN	16	73012918	missense	probably damaging	0.96
IGL02974:Robo1	APN	16	73006862	missense	probably benign	0.09
IGL03233:Robo1	APN	16	72970193	missense	probably damaging	0.99
PIT4378001:Robo1	UTSW	16	73004535	missense	probably damaging	1.00
R0079:Robo1	UTSW	16	72933342	splice site	probably benign
R0254:Robo1	UTSW	16	72664170	missense	probably benign	0.00
R0366:Robo1	UTSW	16	72742245	missense	possibly damaging	0.52
R0410:Robo1	UTSW	16	72971984	missense	possibly damaging	0.59
R0511:Robo1	UTSW	16	73013125	critical splice donor site	probably null
R0563:Robo1	UTSW	16	72972286	missense	probably benign	0.01
R0637:Robo1	UTSW	16	73001951	missense	probably benign	0.29
R1239:Robo1	UTSW	16	73024542	splice site	probably null
R1773:Robo1	UTSW	16	73004511	missense	probably benign	0.00
R1777:Robo1	UTSW	16	73004667	missense	probably benign
R1901:Robo1	UTSW	16	72960204	missense	probably null	1.00
R1902:Robo1	UTSW	16	72960204	missense	probably null	1.00
R1903:Robo1	UTSW	16	72960204	missense	probably null	1.00
R1996:Robo1	UTSW	16	72970179	missense	probably benign	0.40
R2040:Robo1	UTSW	16	72933742	missense	probably damaging	1.00
R2266:Robo1	UTSW	16	72978772	missense	probably benign
R2269:Robo1	UTSW	16	72978772	missense	probably benign
R2433:Robo1	UTSW	16	72970239	missense	probably benign	0.01
R3084:Robo1	UTSW	16	73004737	missense	probably benign	0.02
R3085:Robo1	UTSW	16	73002010	missense	possibly damaging	0.81
R3150:Robo1	UTSW	16	72970269	missense	possibly damaging	0.57
R3418:Robo1	UTSW	16	73035917	missense	probably benign	0.00
R3610:Robo1	UTSW	16	72983770	missense	probably benign	0.00
R3940:Robo1	UTSW	16	73009743	missense	probably benign
R3953:Robo1	UTSW	16	73024338	missense	probably damaging	1.00
R4692:Robo1	UTSW	16	72960202	missense	probably damaging	1.00
R4726:Robo1	UTSW	16	72972043	missense	probably damaging	1.00
R4814:Robo1	UTSW	16	72972035	missense	probably benign	0.11
R4884:Robo1	UTSW	16	72904751	missense	probably damaging	1.00
R4992:Robo1	UTSW	16	72979868	missense	probably damaging	0.98
R5150:Robo1	UTSW	16	72972304	missense	possibly damaging	0.79
R5183:Robo1	UTSW	16	72742150	missense	probably benign	0.03
R5360:Robo1	UTSW	16	72935777	missense	probably damaging	0.96
R5629:Robo1	UTSW	16	72983710	missense	probably benign	0.33
R5804:Robo1	UTSW	16	73043189	critical splice donor site	probably null
R6107:Robo1	UTSW	16	72983829	missense	probably benign	0.00
R6127:Robo1	UTSW	16	73013068	missense	probably benign
R6128:Robo1	UTSW	16	73013068	missense	probably benign
R6129:Robo1	UTSW	16	73013068	missense	probably benign
R6191:Robo1	UTSW	16	72933808	missense	probably benign	0.00
R6357:Robo1	UTSW	16	72970302	missense	probably benign	0.00
R6408:Robo1	UTSW	16	72972046	missense	probably benign	0.00
R6516:Robo1	UTSW	16	73024353	missense	probably benign	0.14
R6600:Robo1	UTSW	16	72989655	missense	probably damaging	1.00
R6802:Robo1	UTSW	16	72933313	missense	probably benign	0.17
R7105:Robo1	UTSW	16	72742161	missense	probably damaging	1.00
R7189:Robo1	UTSW	16	72960151	nonsense	probably null
R7290:Robo1	UTSW	16	73004520	missense	probably benign	0.03
R7296:Robo1	UTSW	16	72989631	nonsense	probably null
R7576:Robo1	UTSW	16	72970181	missense	probably damaging	0.99
R7605:Robo1	UTSW	16	73024301	missense	probably benign	0.14
R7607:Robo1	UTSW	16	72563738	missense
R7634:Robo1	UTSW	16	73042978	splice site	probably null
R7636:Robo1	UTSW	16	72563727	missense
R7857:Robo1	UTSW	16	72970211	missense	probably damaging	1.00
R7966:Robo1	UTSW	16	72983872	missense	possibly damaging	0.62
R7997:Robo1	UTSW	16	72904693	missense	probably damaging	1.00
R8101:Robo1	UTSW	16	72978581	missense	probably benign	0.03
R8191:Robo1	UTSW	16	72933254	missense	probably damaging	1.00
R8218:Robo1	UTSW	16	72989790	missense	possibly damaging	0.91
R8228:Robo1	UTSW	16	73012880	missense	probably benign	0.30
R8292:Robo1	UTSW	16	72972532	missense	possibly damaging	0.61
R8298:Robo1	UTSW	16	72972132	intron	probably benign
R8332:Robo1	UTSW	16	72978578	missense	probably damaging	1.00
R8492:Robo1	UTSW	16	73013023	missense	probably benign	0.06
R8730:Robo1	UTSW	16	72989607	missense	probably benign	0.08
R8774:Robo1	UTSW	16	73035831	missense	probably benign	0.00
R8774-TAIL:Robo1	UTSW	16	73035831	missense	probably benign	0.00
R8776:Robo1	UTSW	16	73024253	nonsense	probably null
R8776-TAIL:Robo1	UTSW	16	73024253	nonsense	probably null
R8905:Robo1	UTSW	16	72742285	missense	probably damaging	1.00
R8913:Robo1	UTSW	16	72904734	missense	probably damaging	1.00
R9003:Robo1	UTSW	16	72742114	splice site	probably benign
R9246:Robo1	UTSW	16	72972290	missense	probably benign
R9451:Robo1	UTSW	16	73006830	missense	probably benign	0.10
Z1176:Robo1	UTSW	16	72977800	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- CCGAAGGCTGTTGTTACGTG -3'
(R):5'- ACATTACGGTCAGCTTCTCATC -3'

Sequencing Primer
(F):5'- AGACCCCAGCATCCAGTGTTG -3'
(R):5'- ACGGTCAGCTTCTCATCATCAC -3'

Posted On

2020-10-20