Mutagenetix > Incidental Mutation

Incidental Mutation 'R1742:Tollip'

200426

Institutional Source

Beutler Lab

Gene Symbol

Tollip

Ensembl Gene

ENSMUSG00000025139

Gene Name

toll interacting protein

Synonyms

4930403G24Rik, Toll interacting protein, 4931428G15Rik

MMRRC Submission

039774-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R1742 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141874813-141918507 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 141892855 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 19 (R19L)

Ref Sequence

ENSEMBL: ENSMUSP00000117938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001950] [ENSMUST00000055819] [ENSMUST00000130439] [ENSMUST00000151890]

AlphaFold

Q9QZ06

Predicted Effect

probably damaging
Transcript: ENSMUST00000001950
AA Change: R23L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000001950
Gene: ENSMUSG00000025139
AA Change: R23L

Domain	Start	End	E-Value	Type
low complexity region	28	44	N/A	INTRINSIC
C2	54	151	1.32e-6	SMART
low complexity region	175	190	N/A	INTRINSIC
low complexity region	213	225	N/A	INTRINSIC
CUE	229	271	1.43e-15	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000055819
AA Change: R23L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000051485
Gene: ENSMUSG00000025139
AA Change: R23L

Domain	Start	End	E-Value	Type
low complexity region	28	44	N/A	INTRINSIC
C2	54	151	1.32e-6	SMART
low complexity region	175	190	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000130439
AA Change: R19L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117938
Gene: ENSMUSG00000025139
AA Change: R19L

Domain	Start	End	E-Value	Type
low complexity region	24	40	N/A	INTRINSIC
Pfam:C2	51	115	6e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000151890

SMART Domains

Protein: ENSMUSP00000118336
Gene: ENSMUSG00000025139

Domain	Start	End	E-Value	Type
Pfam:C2	1	66	1.9e-8	PFAM
low complexity region	106	121	N/A	INTRINSIC
low complexity region	144	156	N/A	INTRINSIC
CUE	160	202	1.43e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211231

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-binding protein that interacts with several Toll-like receptor (TLR) signaling cascade components. The encoded protein regulates inflammatory signaling and is involved in interleukin-1 receptor trafficking and in the turnover of IL1R-associated kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display normal immune cell composition but reduced cytokine production when stimulated with low concentrations of some inducers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	T	2: 130,740,395		probably null	Het
Ankhd1	C	A	18: 36,625,265	A1004E	probably damaging	Het
Arfgef2	A	G	2: 166,866,980	S1071G	probably damaging	Het
Arhgef5	T	A	6: 43,280,199	I1228N	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bptf	A	G	11: 107,110,951	V445A	probably damaging	Het
Btf3	C	T	13: 98,316,296	M1I	probably null	Het
Bves	C	T	10: 45,347,865	T207M	probably damaging	Het
Ccdc171	T	A	4: 83,681,284	S779T	probably damaging	Het
Ccdc54	T	C	16: 50,590,238	K222E	possibly damaging	Het
Cebpe	A	G	14: 54,711,600	V120A	probably benign	Het
Clhc1	T	A	11: 29,557,647		probably null	Het
Col22a1	C	T	15: 71,801,913	G985S	unknown	Het
Col6a3	T	A	1: 90,813,794	I639F	probably damaging	Het
Cryga	C	A	1: 65,103,121	V38L	probably benign	Het
Dll3	T	C	7: 28,294,423	T530A	probably benign	Het
Dnah7a	G	A	1: 53,456,684	P3205S	probably benign	Het
Dpp10	T	A	1: 123,445,206	Y224F	probably damaging	Het
Fcrls	T	C	3: 87,259,043	T142A	possibly damaging	Het
Fyttd1	C	T	16: 32,905,553	R175*	probably null	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gm11487	T	C	4: 73,401,210	D99G	probably damaging	Het
Gm8332	C	T	12: 88,249,683	D140N	unknown	Het
Gpr33	T	C	12: 52,024,262		probably null	Het
Gse1	T	A	8: 120,566,950	V205E	probably damaging	Het
Herc4	C	A	10: 63,287,949	N461K	probably benign	Het
Ifi206	G	A	1: 173,481,971	T153I	probably benign	Het
Iqca	T	C	1: 90,098,051	I341V	probably benign	Het
Itsn1	T	G	16: 91,816,959		probably null	Het
Kcnk5	T	A	14: 20,141,857	Y412F	probably benign	Het
Lemd1	T	A	1: 132,228,298	I26K	probably damaging	Het
Lipc	A	T	9: 70,820,529	L12Q	probably damaging	Het
Lrrtm1	C	A	6: 77,244,091	P177Q	probably damaging	Het
Mcph1	G	A	8: 18,607,363	G73R	probably benign	Het
Myh11	A	T	16: 14,220,044	L899Q	probably damaging	Het
Myo18a	G	T	11: 77,841,467	R822L	probably damaging	Het
Nav3	T	C	10: 109,769,213	T1000A	probably benign	Het
Nox4	T	C	7: 87,295,818	V94A	possibly damaging	Het
Olfr1115	T	A	2: 87,252,778	N280K	probably benign	Het
Olfr1230	G	T	2: 89,296,424	P282H	probably damaging	Het
Olfr850	A	G	9: 19,478,041	S67P	probably damaging	Het
Oxr1	T	C	15: 41,850,559	L679P	probably damaging	Het
Pcdhb17	T	C	18: 37,486,576	I473T	probably damaging	Het
Pgbd5	T	A	8: 124,380,307	E165D	probably damaging	Het
Pgpep1l	A	T	7: 68,237,054	V169D	probably damaging	Het
Phf12	C	T	11: 78,009,486	T136I	probably benign	Het
Pif1	T	A	9: 65,587,850	M14K	probably benign	Het
Pigr	A	G	1: 130,845,086	E347G	probably damaging	Het
Plekha3	G	A	2: 76,682,879	E103K	possibly damaging	Het
Ptgs2	A	G	1: 150,104,399	I363V	probably damaging	Het
Rasl11a	T	A	5: 146,846,995		probably null	Het
Recql	T	C	6: 142,364,572	T511A	probably damaging	Het
Rgl2	T	A	17: 33,937,223		probably null	Het
Rpp25l	T	C	4: 41,712,763	Y4C	probably damaging	Het
Sass6	T	G	3: 116,607,477	C156G	probably damaging	Het
Sgta	T	G	10: 81,046,277	N288T	probably damaging	Het
Slco1a4	T	A	6: 141,825,045	T282S	probably benign	Het
Smad4	T	C	18: 73,675,897	R100G	probably damaging	Het
Sox8	C	T	17: 25,567,941	V263M	probably damaging	Het
Sp8	A	G	12: 118,849,817	H469R	probably benign	Het
Spata1	A	T	3: 146,469,623		probably null	Het
Taar7a	G	A	10: 23,993,219	S88F	probably damaging	Het
Tnks2	T	C	19: 36,876,261	L749S	probably damaging	Het
Tox2	G	A	2: 163,225,526	R55H	probably benign	Het
Vmn2r27	T	C	6: 124,200,677	E456G	possibly damaging	Het
Vmn2r77	T	A	7: 86,795,335	N65K	probably benign	Het
Vwf	T	C	6: 125,667,550	M2456T	probably benign	Het
Zfp526	A	G	7: 25,224,514	N66S	possibly damaging	Het
Zic1	T	C	9: 91,361,576	Y446C	probably damaging	Het

Other mutations in Tollip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1404:Tollip	UTSW	7	141884555	missense	probably benign	0.00
R1404:Tollip	UTSW	7	141884555	missense	probably benign	0.00
R2443:Tollip	UTSW	7	141890823	nonsense	probably null
R4092:Tollip	UTSW	7	141884443	missense	probably damaging	1.00
R5192:Tollip	UTSW	7	141892117	missense	probably damaging	1.00
R5614:Tollip	UTSW	7	141892088	missense	probably damaging	1.00
R6132:Tollip	UTSW	7	141889597	missense	probably benign	0.37
R6805:Tollip	UTSW	7	141890845	missense	probably benign	0.21
R6830:Tollip	UTSW	7	141898714	start codon destroyed	probably null	0.00
R7366:Tollip	UTSW	7	141889597	missense	probably benign	0.37
R7509:Tollip	UTSW	7	141892141	missense	probably benign	0.36
R7759:Tollip	UTSW	7	141884539	missense	probably benign
R8024:Tollip	UTSW	7	141892826	missense	probably benign
R9574:Tollip	UTSW	7	141891994	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTACAATGCCTGACATGGACCAAC -3'
(R):5'- AACTTTGGTAAGGTGAGCAGAGCTG -3'

Sequencing Primer
(F):5'- CTTAGGCAGATCCCTGAGGAATC -3'
(R):5'- CTGGACTGTGCCTGAGTGAC -3'

Posted On

2014-05-23