Mutagenetix > Incidental Mutation

Incidental Mutation 'R1742:Arhgef5'

200414

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

039774-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1742 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43280199 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1228 (I1228N)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: I1228N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: I1228N

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182752

Predicted Effect

probably damaging
Transcript: ENSMUST00000182924
AA Change: I496N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183313

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	T	2: 130,740,395		probably null	Het
Ankhd1	C	A	18: 36,625,265	A1004E	probably damaging	Het
Arfgef2	A	G	2: 166,866,980	S1071G	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bptf	A	G	11: 107,110,951	V445A	probably damaging	Het
Btf3	C	T	13: 98,316,296	M1I	probably null	Het
Bves	C	T	10: 45,347,865	T207M	probably damaging	Het
Ccdc171	T	A	4: 83,681,284	S779T	probably damaging	Het
Ccdc54	T	C	16: 50,590,238	K222E	possibly damaging	Het
Cebpe	A	G	14: 54,711,600	V120A	probably benign	Het
Clhc1	T	A	11: 29,557,647		probably null	Het
Col22a1	C	T	15: 71,801,913	G985S	unknown	Het
Col6a3	T	A	1: 90,813,794	I639F	probably damaging	Het
Cryga	C	A	1: 65,103,121	V38L	probably benign	Het
Dll3	T	C	7: 28,294,423	T530A	probably benign	Het
Dnah7a	G	A	1: 53,456,684	P3205S	probably benign	Het
Dpp10	T	A	1: 123,445,206	Y224F	probably damaging	Het
Fcrls	T	C	3: 87,259,043	T142A	possibly damaging	Het
Fyttd1	C	T	16: 32,905,553	R175*	probably null	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gm11487	T	C	4: 73,401,210	D99G	probably damaging	Het
Gm8332	C	T	12: 88,249,683	D140N	unknown	Het
Gpr33	T	C	12: 52,024,262		probably null	Het
Gse1	T	A	8: 120,566,950	V205E	probably damaging	Het
Herc4	C	A	10: 63,287,949	N461K	probably benign	Het
Ifi206	G	A	1: 173,481,971	T153I	probably benign	Het
Iqca	T	C	1: 90,098,051	I341V	probably benign	Het
Itsn1	T	G	16: 91,816,959		probably null	Het
Kcnk5	T	A	14: 20,141,857	Y412F	probably benign	Het
Lemd1	T	A	1: 132,228,298	I26K	probably damaging	Het
Lipc	A	T	9: 70,820,529	L12Q	probably damaging	Het
Lrrtm1	C	A	6: 77,244,091	P177Q	probably damaging	Het
Mcph1	G	A	8: 18,607,363	G73R	probably benign	Het
Myh11	A	T	16: 14,220,044	L899Q	probably damaging	Het
Myo18a	G	T	11: 77,841,467	R822L	probably damaging	Het
Nav3	T	C	10: 109,769,213	T1000A	probably benign	Het
Nox4	T	C	7: 87,295,818	V94A	possibly damaging	Het
Olfr1115	T	A	2: 87,252,778	N280K	probably benign	Het
Olfr1230	G	T	2: 89,296,424	P282H	probably damaging	Het
Olfr850	A	G	9: 19,478,041	S67P	probably damaging	Het
Oxr1	T	C	15: 41,850,559	L679P	probably damaging	Het
Pcdhb17	T	C	18: 37,486,576	I473T	probably damaging	Het
Pgbd5	T	A	8: 124,380,307	E165D	probably damaging	Het
Pgpep1l	A	T	7: 68,237,054	V169D	probably damaging	Het
Phf12	C	T	11: 78,009,486	T136I	probably benign	Het
Pif1	T	A	9: 65,587,850	M14K	probably benign	Het
Pigr	A	G	1: 130,845,086	E347G	probably damaging	Het
Plekha3	G	A	2: 76,682,879	E103K	possibly damaging	Het
Ptgs2	A	G	1: 150,104,399	I363V	probably damaging	Het
Rasl11a	T	A	5: 146,846,995		probably null	Het
Recql	T	C	6: 142,364,572	T511A	probably damaging	Het
Rgl2	T	A	17: 33,937,223		probably null	Het
Rpp25l	T	C	4: 41,712,763	Y4C	probably damaging	Het
Sass6	T	G	3: 116,607,477	C156G	probably damaging	Het
Sgta	T	G	10: 81,046,277	N288T	probably damaging	Het
Slco1a4	T	A	6: 141,825,045	T282S	probably benign	Het
Smad4	T	C	18: 73,675,897	R100G	probably damaging	Het
Sox8	C	T	17: 25,567,941	V263M	probably damaging	Het
Sp8	A	G	12: 118,849,817	H469R	probably benign	Het
Spata1	A	T	3: 146,469,623		probably null	Het
Taar7a	G	A	10: 23,993,219	S88F	probably damaging	Het
Tnks2	T	C	19: 36,876,261	L749S	probably damaging	Het
Tollip	C	A	7: 141,892,855	R19L	probably damaging	Het
Tox2	G	A	2: 163,225,526	R55H	probably benign	Het
Vmn2r27	T	C	6: 124,200,677	E456G	possibly damaging	Het
Vmn2r77	T	A	7: 86,795,335	N65K	probably benign	Het
Vwf	T	C	6: 125,667,550	M2456T	probably benign	Het
Zfp526	A	G	7: 25,224,514	N66S	possibly damaging	Het
Zic1	T	C	9: 91,361,576	Y446C	probably damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GTACTACATAGCAAGGGCACAGAGC -3'
(R):5'- TCTGATATGGGCAATGGGCTGAAAC -3'

Sequencing Primer
(F):5'- GCACAGAGCTAAGGAGAGTC -3'
(R):5'- TTCAGATGACATAGCAGGCAC -3'

Posted On

2014-05-23