Incidental Mutation 'R1742:Taar7a'
ID 200437
Institutional Source Beutler Lab
Gene Symbol Taar7a
Ensembl Gene ENSMUSG00000095647
Gene Name trace amine-associated receptor 7A
Synonyms Taar7a, LOC215856
MMRRC Submission 039774-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R1742 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 23992405-23993481 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 23993219 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 88 (S88F)
Ref Sequence ENSEMBL: ENSMUSP00000077616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078532]
AlphaFold Q5QD12
Predicted Effect probably damaging
Transcript: ENSMUST00000078532
AA Change: S88F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077616
Gene: ENSMUSG00000095647
AA Change: S88F

DomainStartEndE-ValueType
Pfam:7tm_4 54 344 9.2e-10 PFAM
Pfam:7TM_GPCR_Srx 56 261 5.2e-9 PFAM
Pfam:7tm_1 64 326 3.2e-58 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,740,395 (GRCm38) probably null Het
Ankhd1 C A 18: 36,625,265 (GRCm38) A1004E probably damaging Het
Arfgef2 A G 2: 166,866,980 (GRCm38) S1071G probably damaging Het
Arhgef5 T A 6: 43,280,199 (GRCm38) I1228N probably damaging Het
Auh G A 13: 52,835,496 (GRCm38) P308L probably benign Het
Bptf A G 11: 107,110,951 (GRCm38) V445A probably damaging Het
Btf3 C T 13: 98,316,296 (GRCm38) M1I probably null Het
Bves C T 10: 45,347,865 (GRCm38) T207M probably damaging Het
Ccdc171 T A 4: 83,681,284 (GRCm38) S779T probably damaging Het
Ccdc54 T C 16: 50,590,238 (GRCm38) K222E possibly damaging Het
Cebpe A G 14: 54,711,600 (GRCm38) V120A probably benign Het
Clhc1 T A 11: 29,557,647 (GRCm38) probably null Het
Col22a1 C T 15: 71,801,913 (GRCm38) G985S unknown Het
Col6a3 T A 1: 90,813,794 (GRCm38) I639F probably damaging Het
Cryga C A 1: 65,103,121 (GRCm38) V38L probably benign Het
Dll3 T C 7: 28,294,423 (GRCm38) T530A probably benign Het
Dnah7a G A 1: 53,456,684 (GRCm38) P3205S probably benign Het
Dpp10 T A 1: 123,445,206 (GRCm38) Y224F probably damaging Het
Fcrls T C 3: 87,259,043 (GRCm38) T142A possibly damaging Het
Fyttd1 C T 16: 32,905,553 (GRCm38) R175* probably null Het
Gm10277 TC T 11: 77,786,002 (GRCm38) probably null Het
Gm11487 T C 4: 73,401,210 (GRCm38) D99G probably damaging Het
Gm8332 C T 12: 88,249,683 (GRCm38) D140N unknown Het
Gpr33 T C 12: 52,024,262 (GRCm38) probably null Het
Gse1 T A 8: 120,566,950 (GRCm38) V205E probably damaging Het
Herc4 C A 10: 63,287,949 (GRCm38) N461K probably benign Het
Ifi206 G A 1: 173,481,971 (GRCm38) T153I probably benign Het
Iqca T C 1: 90,098,051 (GRCm38) I341V probably benign Het
Itsn1 T G 16: 91,816,959 (GRCm38) probably null Het
Kcnk5 T A 14: 20,141,857 (GRCm38) Y412F probably benign Het
Lemd1 T A 1: 132,228,298 (GRCm38) I26K probably damaging Het
Lipc A T 9: 70,820,529 (GRCm38) L12Q probably damaging Het
Lrrtm1 C A 6: 77,244,091 (GRCm38) P177Q probably damaging Het
Mcph1 G A 8: 18,607,363 (GRCm38) G73R probably benign Het
Myh11 A T 16: 14,220,044 (GRCm38) L899Q probably damaging Het
Myo18a G T 11: 77,841,467 (GRCm38) R822L probably damaging Het
Nav3 T C 10: 109,769,213 (GRCm38) T1000A probably benign Het
Nox4 T C 7: 87,295,818 (GRCm38) V94A possibly damaging Het
Olfr1115 T A 2: 87,252,778 (GRCm38) N280K probably benign Het
Olfr1230 G T 2: 89,296,424 (GRCm38) P282H probably damaging Het
Olfr850 A G 9: 19,478,041 (GRCm38) S67P probably damaging Het
Oxr1 T C 15: 41,850,559 (GRCm38) L679P probably damaging Het
Pcdhb17 T C 18: 37,486,576 (GRCm38) I473T probably damaging Het
Pgbd5 T A 8: 124,380,307 (GRCm38) E165D probably damaging Het
Pgpep1l A T 7: 68,237,054 (GRCm38) V169D probably damaging Het
Phf12 C T 11: 78,009,486 (GRCm38) T136I probably benign Het
Pif1 T A 9: 65,587,850 (GRCm38) M14K probably benign Het
Pigr A G 1: 130,845,086 (GRCm38) E347G probably damaging Het
Plekha3 G A 2: 76,682,879 (GRCm38) E103K possibly damaging Het
Ptgs2 A G 1: 150,104,399 (GRCm38) I363V probably damaging Het
Rasl11a T A 5: 146,846,995 (GRCm38) probably null Het
Recql T C 6: 142,364,572 (GRCm38) T511A probably damaging Het
Rgl2 T A 17: 33,937,223 (GRCm38) probably null Het
Rpp25l T C 4: 41,712,763 (GRCm38) Y4C probably damaging Het
Sass6 T G 3: 116,607,477 (GRCm38) C156G probably damaging Het
Sgta T G 10: 81,046,277 (GRCm38) N288T probably damaging Het
Slco1a4 T A 6: 141,825,045 (GRCm38) T282S probably benign Het
Smad4 T C 18: 73,675,897 (GRCm38) R100G probably damaging Het
Sox8 C T 17: 25,567,941 (GRCm38) V263M probably damaging Het
Sp8 A G 12: 118,849,817 (GRCm38) H469R probably benign Het
Spata1 A T 3: 146,469,623 (GRCm38) probably null Het
Tnks2 T C 19: 36,876,261 (GRCm38) L749S probably damaging Het
Tollip C A 7: 141,892,855 (GRCm38) R19L probably damaging Het
Tox2 G A 2: 163,225,526 (GRCm38) R55H probably benign Het
Vmn2r27 T C 6: 124,200,677 (GRCm38) E456G possibly damaging Het
Vmn2r77 T A 7: 86,795,335 (GRCm38) N65K probably benign Het
Vwf T C 6: 125,667,550 (GRCm38) M2456T probably benign Het
Zfp526 A G 7: 25,224,514 (GRCm38) N66S possibly damaging Het
Zic1 T C 9: 91,361,576 (GRCm38) Y446C probably damaging Het
Other mutations in Taar7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Taar7a APN 10 23,992,396 (GRCm38) unclassified probably benign
IGL02408:Taar7a APN 10 23,992,602 (GRCm38) missense probably benign
PIT4434001:Taar7a UTSW 10 23,993,421 (GRCm38) missense probably benign
R0422:Taar7a UTSW 10 23,993,274 (GRCm38) missense probably benign 0.02
R1029:Taar7a UTSW 10 23,992,541 (GRCm38) missense possibly damaging 0.65
R2104:Taar7a UTSW 10 23,993,061 (GRCm38) missense probably damaging 0.99
R2421:Taar7a UTSW 10 23,992,517 (GRCm38) missense probably damaging 1.00
R3907:Taar7a UTSW 10 23,992,559 (GRCm38) missense probably benign 0.25
R4021:Taar7a UTSW 10 23,993,386 (GRCm38) missense probably benign 0.00
R5180:Taar7a UTSW 10 23,993,148 (GRCm38) missense probably damaging 1.00
R5486:Taar7a UTSW 10 23,992,458 (GRCm38) missense probably benign 0.00
R5507:Taar7a UTSW 10 23,992,631 (GRCm38) missense probably damaging 0.98
R5587:Taar7a UTSW 10 23,992,828 (GRCm38) missense probably benign 0.00
R5766:Taar7a UTSW 10 23,993,362 (GRCm38) missense probably benign 0.01
R5861:Taar7a UTSW 10 23,992,439 (GRCm38) missense probably benign
R7201:Taar7a UTSW 10 23,992,460 (GRCm38) missense probably benign 0.04
R7506:Taar7a UTSW 10 23,992,994 (GRCm38) missense possibly damaging 0.50
R8810:Taar7a UTSW 10 23,993,381 (GRCm38) missense probably benign 0.20
R9015:Taar7a UTSW 10 23,992,835 (GRCm38) missense probably damaging 0.97
R9172:Taar7a UTSW 10 23,992,779 (GRCm38) missense probably benign 0.16
R9686:Taar7a UTSW 10 23,993,411 (GRCm38) missense probably benign 0.01
R9717:Taar7a UTSW 10 23,992,901 (GRCm38) missense probably benign 0.01
R9720:Taar7a UTSW 10 23,992,835 (GRCm38) missense probably benign 0.10
X0064:Taar7a UTSW 10 23,992,617 (GRCm38) missense probably damaging 1.00
Z1177:Taar7a UTSW 10 23,992,892 (GRCm38) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTGCCAGAAACAGAAGCAGTGAAC -3'
(R):5'- TGAGAACCTGAACAGGTCCTGTGTC -3'

Sequencing Primer
(F):5'- GGGGTCACTGACTGCAATATATC -3'
(R):5'- TGTGTCAGGAGCCCATACTC -3'
Posted On 2014-05-23