Incidental Mutation 'R1792:Slc25a13'
ID201820
Institutional Source Beutler Lab
Gene Symbol Slc25a13
Ensembl Gene ENSMUSG00000015112
Gene Namesolute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13
Synonymscitrin, Ctrn
MMRRC Submission 039822-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R1792 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location6041218-6217173 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6115104 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 207 (A207V)
Ref Sequence ENSEMBL: ENSMUSP00000139571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015256] [ENSMUST00000188414]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015256
AA Change: A207V

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000015256
Gene: ENSMUSG00000015112
AA Change: A207V

DomainStartEndE-ValueType
EFh 57 85 5.75e1 SMART
EFh 91 119 6.14e-1 SMART
EFh 162 190 7.87e1 SMART
Pfam:Mito_carr 327 424 5.2e-27 PFAM
Pfam:Mito_carr 425 516 1.2e-17 PFAM
Pfam:Mito_carr 517 612 1.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188414
AA Change: A207V

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139571
Gene: ENSMUSG00000015112
AA Change: A207V

DomainStartEndE-ValueType
EFh 57 85 5.75e1 SMART
EFh 91 119 6.14e-1 SMART
EFh 162 190 7.87e1 SMART
Pfam:Mito_carr 327 424 2.6e-26 PFAM
Pfam:Mito_carr 425 516 4.4e-19 PFAM
Pfam:Mito_carr 517 612 1.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203990
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene appear normal, healthy and fertile, although they have a number of metabolic defects, but the spontaneous hyperspin deletion spanning from intron 3 to exon 17 also eliminates a modifier of Dlx5 causing a recessive vestibular and mortality phenotype [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 C T 11: 110,184,044 V1398I probably benign Het
Ackr3 A T 1: 90,214,898 N360Y probably benign Het
Acr T G 15: 89,573,143 M198R probably benign Het
Adamts14 A T 10: 61,218,498 M585K probably benign Het
Adgrb3 A T 1: 25,228,471 C853S probably damaging Het
Arhgef28 G T 13: 97,931,186 S1410R probably benign Het
Armc4 T C 18: 7,286,743 T163A probably benign Het
Asprv1 T A 6: 86,628,372 F67I possibly damaging Het
Atp8b4 T A 2: 126,325,294 Y1095F probably benign Het
Cadps A G 14: 12,449,802 S1136P possibly damaging Het
Ccdc36 A C 9: 108,404,912 S526A possibly damaging Het
Ccdc57 T C 11: 120,897,881 Q380R possibly damaging Het
Cdc45 A T 16: 18,807,340 D142E probably benign Het
Cs A T 10: 128,360,079 N386Y possibly damaging Het
Dsc3 A T 18: 19,986,998 V201E probably damaging Het
Dusp26 G T 8: 31,091,935 R19L probably benign Het
Esyt3 C A 9: 99,358,116 E92* probably null Het
Ext2 T C 2: 93,704,545 N625D probably damaging Het
Fam208b T C 13: 3,590,559 K193E possibly damaging Het
Flvcr2 A T 12: 85,747,155 K102* probably null Het
Fmnl2 T A 2: 53,042,317 S103T possibly damaging Het
Fmo4 T A 1: 162,794,290 I451F probably benign Het
Gak A T 5: 108,585,531 Y47* probably null Het
Gbp10 A T 5: 105,224,300 L198Q probably damaging Het
Gm11559 T A 11: 99,864,929 S135T unknown Het
Gm14496 A T 2: 181,996,153 D340V probably benign Het
Grin2a T C 16: 9,992,395 T47A possibly damaging Het
Gtf2ird1 A T 5: 134,366,936 probably null Het
Herc4 T A 10: 63,245,901 M1K probably null Het
Hirip3 T A 7: 126,862,620 V29E probably damaging Het
Hs3st5 A G 10: 36,832,724 D85G probably benign Het
Htt T A 5: 34,907,199 S2981T probably damaging Het
Il20ra G A 10: 19,759,636 V542I probably damaging Het
Itgb2l C A 16: 96,425,082 C603F probably damaging Het
Klhl41 A C 2: 69,670,802 K202N probably benign Het
Lct G A 1: 128,327,942 S121F possibly damaging Het
Lhx6 C T 2: 36,087,375 G355D probably damaging Het
Limk2 A G 11: 3,358,236 V121A probably benign Het
Med1 T G 11: 98,157,283 K896Q probably damaging Het
Muc6 A G 7: 141,634,458 F2789S probably benign Het
Nemf T A 12: 69,312,569 Y997F probably damaging Het
Nrap A G 19: 56,379,158 S296P probably benign Het
Nrxn1 T C 17: 90,588,824 N961D probably damaging Het
Olfr220 T C 1: 174,448,737 V38A probably benign Het
Olfr398 A C 11: 73,983,847 S254A probably benign Het
Olfr777 A T 10: 129,269,243 F27I probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdk4 T A 6: 5,489,166 H247L probably damaging Het
Pkd1l3 T A 8: 109,632,605 V866E probably damaging Het
Pla2g4e G A 2: 120,168,474 P803L probably damaging Het
Pnisr T C 4: 21,860,968 V217A possibly damaging Het
Pole4 G A 6: 82,652,739 P34L unknown Het
Pole4 G T 6: 82,652,740 P34T unknown Het
Ptchd3 G A 11: 121,841,551 W422* probably null Het
Rab1b C T 19: 5,100,485 A167T probably benign Het
Rasal1 T C 5: 120,664,756 M359T probably benign Het
Rexo4 T C 2: 26,960,236 N310D probably benign Het
Rgma C T 7: 73,417,837 T280M probably damaging Het
Rnaset2a A T 17: 8,145,576 I43N probably damaging Het
Rtcb A T 10: 85,942,582 V399E probably damaging Het
Scd4 T G 19: 44,337,574 Y122* probably null Het
Sirt6 T C 10: 81,626,521 I15V possibly damaging Het
Slamf8 A T 1: 172,587,959 V104E possibly damaging Het
Slc12a4 A G 8: 105,951,843 I285T possibly damaging Het
Slc6a21 T C 7: 45,280,731 S185P probably benign Het
Smarcc2 A C 10: 128,463,871 N135T probably damaging Het
Susd6 T C 12: 80,874,291 S221P probably damaging Het
Syne1 C T 10: 5,040,975 G8418D probably damaging Het
Tbc1d7 C T 13: 43,165,377 V95I probably benign Het
Tcerg1l T C 7: 138,361,866 D225G probably benign Het
Tfip11 A T 5: 112,329,397 I82F possibly damaging Het
Tmem41a C T 16: 21,936,981 G192S probably null Het
Trrap G A 5: 144,853,586 A3619T possibly damaging Het
Tspoap1 G A 11: 87,765,881 probably null Het
Wfdc21 T C 11: 83,747,057 S11P probably benign Het
Zc2hc1b A T 10: 13,168,730 V63E probably damaging Het
Other mutations in Slc25a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Slc25a13 APN 6 6042739 critical splice donor site probably null
IGL02237:Slc25a13 APN 6 6042646 missense probably damaging 1.00
IGL02285:Slc25a13 APN 6 6042643 missense possibly damaging 0.95
IGL02287:Slc25a13 APN 6 6216992 splice site probably benign
IGL02593:Slc25a13 APN 6 6042265 missense probably benign 0.00
R0028:Slc25a13 UTSW 6 6181047 missense probably benign 0.10
R0045:Slc25a13 UTSW 6 6109277 missense probably benign 0.05
R0384:Slc25a13 UTSW 6 6042600 nonsense probably null
R0711:Slc25a13 UTSW 6 6117128 missense probably damaging 0.99
R1299:Slc25a13 UTSW 6 6113937 critical splice donor site probably null
R1625:Slc25a13 UTSW 6 6096675 missense probably damaging 1.00
R1701:Slc25a13 UTSW 6 6152525 critical splice acceptor site probably null
R1932:Slc25a13 UTSW 6 6042264 missense probably benign 0.33
R1933:Slc25a13 UTSW 6 6109262 missense probably damaging 1.00
R1952:Slc25a13 UTSW 6 6152482 missense probably damaging 1.00
R1969:Slc25a13 UTSW 6 6096668 critical splice donor site probably null
R2027:Slc25a13 UTSW 6 6073487 missense probably damaging 1.00
R2074:Slc25a13 UTSW 6 6114017 missense probably benign 0.21
R2432:Slc25a13 UTSW 6 6114017 missense probably benign 0.21
R2508:Slc25a13 UTSW 6 6117190 missense probably benign 0.06
R3774:Slc25a13 UTSW 6 6109288 missense probably damaging 1.00
R3775:Slc25a13 UTSW 6 6109288 missense probably damaging 1.00
R4804:Slc25a13 UTSW 6 6109213 missense probably damaging 1.00
R4816:Slc25a13 UTSW 6 6114274 missense possibly damaging 0.71
R4978:Slc25a13 UTSW 6 6042300 missense probably damaging 0.97
R6529:Slc25a13 UTSW 6 6073451 missense probably benign 0.39
R6615:Slc25a13 UTSW 6 6073454 missense probably damaging 1.00
R6709:Slc25a13 UTSW 6 6073440 missense possibly damaging 0.88
R7346:Slc25a13 UTSW 6 6181100 missense possibly damaging 0.67
R7571:Slc25a13 UTSW 6 6052785 missense probably damaging 1.00
R7807:Slc25a13 UTSW 6 6117164 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGCTCCCTAAGACACTTG -3'
(R):5'- ACTCTGTAAATGACTACTGGTCCTG -3'

Sequencing Primer
(F):5'- TGCTCCCTAAGACACTTGAAACAAAC -3'
(R):5'- CCCCTTTAGTTCCAAAACAG -3'
Posted On2014-06-23