Incidental Mutation 'R6709:Slc25a13'
ID529051
Institutional Source Beutler Lab
Gene Symbol Slc25a13
Ensembl Gene ENSMUSG00000015112
Gene Namesolute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13
Synonymscitrin, Ctrn
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R6709 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location6041218-6217173 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6073440 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 473 (S473P)
Ref Sequence ENSEMBL: ENSMUSP00000139571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015256] [ENSMUST00000188414]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015256
AA Change: S473P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000015256
Gene: ENSMUSG00000015112
AA Change: S473P

DomainStartEndE-ValueType
EFh 57 85 5.75e1 SMART
EFh 91 119 6.14e-1 SMART
EFh 162 190 7.87e1 SMART
Pfam:Mito_carr 327 424 5.2e-27 PFAM
Pfam:Mito_carr 425 516 1.2e-17 PFAM
Pfam:Mito_carr 517 612 1.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188414
AA Change: S473P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139571
Gene: ENSMUSG00000015112
AA Change: S473P

DomainStartEndE-ValueType
EFh 57 85 5.75e1 SMART
EFh 91 119 6.14e-1 SMART
EFh 162 190 7.87e1 SMART
Pfam:Mito_carr 327 424 2.6e-26 PFAM
Pfam:Mito_carr 425 516 4.4e-19 PFAM
Pfam:Mito_carr 517 612 1.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203551
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene appear normal, healthy and fertile, although they have a number of metabolic defects, but the spontaneous hyperspin deletion spanning from intron 3 to exon 17 also eliminates a modifier of Dlx5 causing a recessive vestibular and mortality phenotype [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,554,517 D36G possibly damaging Het
Actn1 T A 12: 80,193,644 D223V probably damaging Het
Adgre1 A T 17: 57,406,917 N201Y probably benign Het
Agbl4 T A 4: 111,566,782 probably benign Het
Atg4d T C 9: 21,268,648 Y272H probably damaging Het
Ccdc39 T C 3: 33,830,093 T367A possibly damaging Het
Ceacam2 T C 7: 25,529,837 T293A possibly damaging Het
Col19a1 C T 1: 24,282,496 G977E probably damaging Het
Csnka2ip A T 16: 64,478,569 H33Q possibly damaging Het
Cyp3a44 A T 5: 145,778,092 probably null Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dnah12 A G 14: 26,872,749 D3492G probably damaging Het
Eepd1 A T 9: 25,482,868 T143S probably benign Het
Eml2 A G 7: 19,206,211 *650W probably null Het
Etv1 C T 12: 38,783,797 T19I possibly damaging Het
Fam133b T C 5: 3,569,059 probably benign Het
Fgd4 T C 16: 16,484,481 H70R probably benign Het
Galnt11 C T 5: 25,248,853 R26C probably damaging Het
Gm136 T A 4: 34,755,884 Y43F probably damaging Het
Gm17409 A T 2: 58,471,076 probably null Het
Gm5591 A G 7: 38,522,075 I190T probably benign Het
Hils1 T A 11: 94,967,946 S22R possibly damaging Het
Htra1 C T 7: 130,936,218 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints8 A T 4: 11,221,117 Y753N possibly damaging Het
L3mbtl3 G A 10: 26,282,797 T651I unknown Het
Ltb4r2 A C 14: 55,762,533 T204P possibly damaging Het
Ltbp3 G A 19: 5,747,857 probably null Het
Mlxip A T 5: 123,447,276 I616F possibly damaging Het
Mpz A T 1: 171,150,732 probably benign Het
Myh11 A G 16: 14,223,494 probably null Het
Myo7a A G 7: 98,054,699 L1949P probably damaging Het
Olfm2 A G 9: 20,672,713 Y116H probably damaging Het
Olfr328 T C 11: 58,552,036 M68V probably benign Het
Olfr750 A T 14: 51,070,829 L188H probably damaging Het
Pde4d T G 13: 109,948,279 L470R probably damaging Het
Plxna2 T A 1: 194,789,766 N1013K probably benign Het
Ptpn13 A C 5: 103,586,756 Q2118P probably benign Het
Pwwp2a C G 11: 43,704,727 L240V probably damaging Het
Reep2 T C 18: 34,846,210 L196P probably benign Het
Shank1 A T 7: 44,354,176 N1765I probably benign Het
Slc33a1 C A 3: 63,944,701 M450I possibly damaging Het
Slc45a2 A G 15: 11,001,130 Y105C possibly damaging Het
Slc4a11 A T 2: 130,684,696 L812Q probably damaging Het
Sox6 T C 7: 115,701,789 probably null Het
Ssfa2 A G 2: 79,644,932 T412A probably benign Het
Sv2b A T 7: 75,124,139 M528K probably benign Het
Syngr4 A G 7: 45,888,698 V82A probably benign Het
Tmem185b G A 1: 119,526,874 V122I probably benign Het
Trdn A G 10: 33,464,591 D607G probably benign Het
Trim10 T A 17: 36,872,370 I186N probably damaging Het
Trp53i11 A T 2: 93,199,818 M157L probably benign Het
Ubr3 C A 2: 70,013,092 H1559N probably damaging Het
Usp25 A C 16: 77,083,932 E727A probably benign Het
Vmn2r42 T A 7: 8,192,619 R509S probably benign Het
Vmn2r69 T C 7: 85,411,861 N172D probably benign Het
Zfp14 T C 7: 30,038,132 Y476C probably damaging Het
Other mutations in Slc25a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Slc25a13 APN 6 6042739 critical splice donor site probably null
IGL02237:Slc25a13 APN 6 6042646 missense probably damaging 1.00
IGL02285:Slc25a13 APN 6 6042643 missense possibly damaging 0.95
IGL02287:Slc25a13 APN 6 6216992 splice site probably benign
IGL02593:Slc25a13 APN 6 6042265 missense probably benign 0.00
R0028:Slc25a13 UTSW 6 6181047 missense probably benign 0.10
R0045:Slc25a13 UTSW 6 6109277 missense probably benign 0.05
R0384:Slc25a13 UTSW 6 6042600 nonsense probably null
R0711:Slc25a13 UTSW 6 6117128 missense probably damaging 0.99
R1299:Slc25a13 UTSW 6 6113937 critical splice donor site probably null
R1625:Slc25a13 UTSW 6 6096675 missense probably damaging 1.00
R1701:Slc25a13 UTSW 6 6152525 critical splice acceptor site probably null
R1792:Slc25a13 UTSW 6 6115104 missense possibly damaging 0.79
R1932:Slc25a13 UTSW 6 6042264 missense probably benign 0.33
R1933:Slc25a13 UTSW 6 6109262 missense probably damaging 1.00
R1952:Slc25a13 UTSW 6 6152482 missense probably damaging 1.00
R1969:Slc25a13 UTSW 6 6096668 critical splice donor site probably null
R2027:Slc25a13 UTSW 6 6073487 missense probably damaging 1.00
R2074:Slc25a13 UTSW 6 6114017 missense probably benign 0.21
R2432:Slc25a13 UTSW 6 6114017 missense probably benign 0.21
R2508:Slc25a13 UTSW 6 6117190 missense probably benign 0.06
R3774:Slc25a13 UTSW 6 6109288 missense probably damaging 1.00
R3775:Slc25a13 UTSW 6 6109288 missense probably damaging 1.00
R4804:Slc25a13 UTSW 6 6109213 missense probably damaging 1.00
R4816:Slc25a13 UTSW 6 6114274 missense possibly damaging 0.71
R4978:Slc25a13 UTSW 6 6042300 missense probably damaging 0.97
R6529:Slc25a13 UTSW 6 6073451 missense probably benign 0.39
R6615:Slc25a13 UTSW 6 6073454 missense probably damaging 1.00
R7346:Slc25a13 UTSW 6 6181100 missense possibly damaging 0.67
R7571:Slc25a13 UTSW 6 6052785 missense probably damaging 1.00
R7807:Slc25a13 UTSW 6 6117164 missense probably damaging 0.99
R7852:Slc25a13 UTSW 6 6152461 missense probably damaging 0.96
R7935:Slc25a13 UTSW 6 6152461 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGCAATTTGCTGGCAGATG -3'
(R):5'- TGAGTTATCTGAGACCATCAATCC -3'

Sequencing Primer
(F):5'- CAATTTGCTGGCAGATGGTAGGAG -3'
(R):5'- CAATCCATGGTGATGAATATCCC -3'
Posted On2018-07-24