Incidental Mutation 'R1817:Acly'
List |< first << previous [record 2 of 89] next >> last >|
ID204525
Institutional Source Beutler Lab
Gene Symbol Acly
Ensembl Gene ENSMUSG00000020917
Gene NameATP citrate lyase
SynonymsA730098H14Rik
MMRRC Submission 039845-MU
Accession Numbers

NCBI RefSeq: NM_001199296.1, NM_134037.3; MGI: 103251

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1817 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100476353-100528000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100495891 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 615 (Q615L)
Ref Sequence ENSEMBL: ENSMUSP00000103012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007131] [ENSMUST00000107385] [ENSMUST00000107389] [ENSMUST00000165111]
Predicted Effect probably benign
Transcript: ENSMUST00000007131
AA Change: Q605L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007131
Gene: ENSMUSG00000020917
AA Change: Q605L

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107385
SMART Domains Protein: ENSMUSP00000103008
Gene: ENSMUSG00000020917

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.1e-6 PFAM
SCOP:d1eucb1 255 417 1e-26 SMART
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107389
AA Change: Q615L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103012
Gene: ENSMUSG00000020917
AA Change: Q615L

DomainStartEndE-ValueType
Pfam:Citrate_bind 244 421 1.7e-94 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 494 600 6.6e-15 PFAM
Pfam:Ligase_CoA 660 785 2.1e-16 PFAM
Pfam:Citrate_synt 879 1085 2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154888
Predicted Effect probably benign
Transcript: ENSMUST00000165111
AA Change: Q605L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127632
Gene: ENSMUSG00000020917
AA Change: Q605L

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (90/95)
MGI Phenotype Strain: 5287022; 3036686
Lethality: E7-E8
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATP citrate lyase is the primary enzyme responsible for the synthesis of cytosolic acetyl-CoA in many tissues. The enzyme is a tetramer (relative molecular weight approximately 440,000) of apparently identical subunits. It catalyzes the formation of acetyl-CoA and oxaloacetate from citrate and CoA with a concomitant hydrolysis of ATP to ADP and phosphate. The product, acetyl-CoA, serves several important biosynthetic pathways, including lipogenesis and cholesterogenesis. In nervous tissue, ATP citrate-lyase may be involved in the biosynthesis of acetylcholine. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mutation of this gene results in embryonic lethality. Heterozygous mutants display no obvious abnormalities. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI

All alleles(37) : Targeted(1) Gene trapped(35) Transgenic(1)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,318 S600T probably benign Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afg3l1 G T 8: 123,501,931 K745N probably damaging Het
Armc8 T C 9: 99,536,259 T39A possibly damaging Het
Atm C A 9: 53,492,233 probably benign Het
Babam2 A G 5: 32,057,546 T324A probably damaging Het
Btd C A 14: 31,662,289 D77E possibly damaging Het
Cadm1 T A 9: 47,829,370 probably benign Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccni G T 5: 93,188,108 T144K possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cpsf7 T C 19: 10,535,439 F296L possibly damaging Het
Cyfip1 C A 7: 55,873,448 N70K possibly damaging Het
Cyp4a12b A G 4: 115,414,062 probably benign Het
Ddx20 A T 3: 105,678,580 Y816* probably null Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dgat1 T A 15: 76,502,503 M445L probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dnmt1 T C 9: 20,927,126 T215A probably benign Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Enox1 A G 14: 77,615,475 I394V possibly damaging Het
Esrp2 A T 8: 106,134,618 M183K probably damaging Het
Fam171a1 C T 2: 3,178,373 P79S probably benign Het
Fga A G 3: 83,031,775 T486A probably benign Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Fnip1 A G 11: 54,502,453 T572A probably benign Het
Fxn A C 19: 24,280,401 probably null Het
Gaa C T 11: 119,284,498 Q901* probably null Het
Gabrg1 A G 5: 70,754,251 M344T probably benign Het
Galnt7 C T 8: 57,538,178 V433M probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm5155 C T 7: 17,873,330 noncoding transcript Het
Hydin A C 8: 110,532,827 D2477A probably benign Het
Igsf6 T C 7: 121,070,808 Y37C probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kif3a T C 11: 53,598,734 Y138H probably damaging Het
Klra17 A G 6: 129,868,718 probably null Het
Lcorl A T 5: 45,795,346 I55N probably damaging Het
Lrrc49 A G 9: 60,602,776 S398P possibly damaging Het
Ltv1 A G 10: 13,179,274 L384S probably damaging Het
Mageb3 A T 2: 121,954,437 Y261* probably null Het
Mb21d1 A G 9: 78,434,311 probably null Het
Mical3 T G 6: 121,042,235 T9P probably benign Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nrap T C 19: 56,384,055 probably benign Het
Olfr164 T C 16: 19,285,877 N289D probably damaging Het
Olfr729 A G 14: 50,148,271 V201A probably benign Het
Otoa A T 7: 121,160,530 probably benign Het
Parp11 T A 6: 127,490,045 I133N probably damaging Het
Pcnx A G 12: 81,918,642 T528A probably benign Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Pdzd7 A T 19: 45,036,176 M468K probably damaging Het
Perm1 C A 4: 156,218,604 P535Q possibly damaging Het
Pgap1 C A 1: 54,535,969 A265S probably benign Het
Pik3c2a A T 7: 116,376,512 probably null Het
Plxnd1 T C 6: 115,980,601 T491A possibly damaging Het
Pms1 A T 1: 53,206,969 D470E probably benign Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Prune2 A G 19: 17,122,081 T1650A probably benign Het
Ptprf A G 4: 118,223,265 L1264P probably benign Het
Ptprs A G 17: 56,419,527 S948P probably damaging Het
Rapgef1 T C 2: 29,686,256 V117A probably damaging Het
Rnf123 A G 9: 108,062,926 V756A probably benign Het
Sez6l2 A G 7: 126,967,119 E741G probably damaging Het
Shc3 A T 13: 51,472,852 I125K possibly damaging Het
Smr3a A T 5: 88,008,058 probably benign Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
St6gal1 A T 16: 23,321,333 K85* probably null Het
Taf1b T G 12: 24,547,122 D353E possibly damaging Het
Tcp10b C T 17: 13,067,703 P180S possibly damaging Het
Tlr9 A T 9: 106,224,943 M478L probably benign Het
Tpr A T 1: 150,419,903 E892D probably damaging Het
Trio C T 15: 27,742,495 W22* probably null Het
Usp14 A G 18: 10,024,673 V8A probably damaging Het
Vmn2r19 A T 6: 123,330,052 K506N possibly damaging Het
Vmn2r45 T A 7: 8,472,373 N552I probably damaging Het
Vmn2r56 A T 7: 12,715,615 M232K probably benign Het
Vps13b T A 15: 35,910,642 F3517L possibly damaging Het
Yif1a C T 19: 5,092,305 R247* probably null Het
Zbtb5 A G 4: 44,993,767 V539A probably benign Het
Zfp180 G A 7: 24,105,227 R357Q probably damaging Het
Zfp536 A G 7: 37,568,617 L458P probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp970 C T 2: 177,476,183 H517Y probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Acly
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Acly APN 11 100495910 missense probably benign 0.00
IGL01661:Acly APN 11 100514342 splice site probably benign
IGL02349:Acly APN 11 100519679 missense probably benign 0.01
IGL02792:Acly APN 11 100478410 missense probably damaging 0.97
IGL03026:Acly APN 11 100519690 missense possibly damaging 0.94
IGL03144:Acly APN 11 100515083 missense possibly damaging 0.84
IGL03230:Acly APN 11 100494059 missense probably damaging 0.99
IGL03266:Acly APN 11 100483752 missense probably damaging 1.00
coyote UTSW 11 100479255 missense probably damaging 0.99
lupine UTSW 11 100515905 missense probably damaging 1.00
P0014:Acly UTSW 11 100484604 missense probably benign 0.03
R0195:Acly UTSW 11 100512974 missense possibly damaging 0.56
R0319:Acly UTSW 11 100504982 missense probably damaging 1.00
R0598:Acly UTSW 11 100478390 missense probably damaging 1.00
R1115:Acly UTSW 11 100479255 missense probably damaging 0.99
R1201:Acly UTSW 11 100493935 missense probably damaging 1.00
R1498:Acly UTSW 11 100483801 missense probably benign 0.27
R1593:Acly UTSW 11 100481755 missense possibly damaging 0.74
R1804:Acly UTSW 11 100515905 missense probably damaging 1.00
R1980:Acly UTSW 11 100495876 missense possibly damaging 0.87
R1997:Acly UTSW 11 100519151 missense probably damaging 1.00
R2125:Acly UTSW 11 100523496 missense probably benign 0.01
R3001:Acly UTSW 11 100504227 missense possibly damaging 0.91
R3002:Acly UTSW 11 100504227 missense possibly damaging 0.91
R3003:Acly UTSW 11 100504227 missense possibly damaging 0.91
R5194:Acly UTSW 11 100523546 missense probably benign
R5509:Acly UTSW 11 100514979 missense probably damaging 0.97
R5594:Acly UTSW 11 100522120 intron probably null
R6077:Acly UTSW 11 100519757 missense probably benign
R6310:Acly UTSW 11 100482220 missense possibly damaging 0.92
R7099:Acly UTSW 11 100492291 intron probably null
R7148:Acly UTSW 11 100483782 missense possibly damaging 0.49
R7149:Acly UTSW 11 100484625 missense probably damaging 1.00
R7349:Acly UTSW 11 100521991 missense probably benign
R7450:Acly UTSW 11 100479275 missense probably damaging 1.00
R7484:Acly UTSW 11 100495963 missense probably damaging 1.00
R7687:Acly UTSW 11 100504854 critical splice donor site probably null
R7728:Acly UTSW 11 100516797 missense probably damaging 1.00
R7728:Acly UTSW 11 100519687 missense probably benign 0.06
R7750:Acly UTSW 11 100478013 critical splice donor site probably null
X0028:Acly UTSW 11 100495933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAACAGCTAGTCATTGTCCTCTG -3'
(R):5'- CTGAGAACACTGGGCTTAGG -3'

Sequencing Primer
(F):5'- CAAGGTCACTTAGGGCTTGCAG -3'
(R):5'- CACTGGGCTTAGGAGGAGG -3'
Posted On2014-06-23