Mutagenetix > Incidental Mutations

Incidental Mutation 'R1817:Tpr'

204467

Institutional Source

Beutler Lab

Gene Symbol

Tpr

Ensembl Gene

ENSMUSG00000006005

Gene Name

translocated promoter region, nuclear basket protein

Synonyms

2610029M07Rik

MMRRC Submission

039845-MU

Accession Numbers

Genbank: NM_133780; MGI: 1922066

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1817 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

150392838-150449935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 150419903 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 892 (E892D)

Ref Sequence

ENSEMBL: ENSMUSP00000112606 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]

AlphaFold

F6ZDS4

Predicted Effect

probably damaging
Transcript: ENSMUST00000119161
AA Change: E892D

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: E892D

Domain	Start	End	E-Value	Type
coiled coil region	49	370	N/A	INTRINSIC
coiled coil region	423	515	N/A	INTRINSIC
low complexity region	518	534	N/A	INTRINSIC
coiled coil region	539	604	N/A	INTRINSIC
low complexity region	690	703	N/A	INTRINSIC
low complexity region	782	795	N/A	INTRINSIC
low complexity region	811	826	N/A	INTRINSIC
low complexity region	1003	1019	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1036	1167	9.1e-33	PFAM
coiled coil region	1215	1421	N/A	INTRINSIC
coiled coil region	1473	1629	N/A	INTRINSIC
internal_repeat_3	1630	1691	1.48e-5	PROSPERO
low complexity region	1695	1717	N/A	INTRINSIC
low complexity region	1761	1777	N/A	INTRINSIC
internal_repeat_5	1814	1827	5.58e-5	PROSPERO
internal_repeat_3	1819	1881	1.48e-5	PROSPERO
internal_repeat_4	1875	1895	5.58e-5	PROSPERO
internal_repeat_1	1893	1919	2.03e-6	PROSPERO
low complexity region	1920	1933	N/A	INTRINSIC
low complexity region	1942	1981	N/A	INTRINSIC
low complexity region	1989	2014	N/A	INTRINSIC
internal_repeat_4	2017	2036	5.58e-5	PROSPERO
low complexity region	2059	2078	N/A	INTRINSIC
internal_repeat_2	2084	2135	3.95e-6	PROSPERO
internal_repeat_5	2127	2140	5.58e-5	PROSPERO
internal_repeat_1	2154	2179	2.03e-6	PROSPERO
internal_repeat_2	2156	2212	3.95e-6	PROSPERO
low complexity region	2239	2251	N/A	INTRINSIC
low complexity region	2263	2277	N/A	INTRINSIC
low complexity region	2292	2314	N/A	INTRINSIC
low complexity region	2346	2357	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124973
AA Change: E966D

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: E966D

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	24	77	N/A	INTRINSIC
coiled coil region	123	444	N/A	INTRINSIC
coiled coil region	497	589	N/A	INTRINSIC
low complexity region	592	608	N/A	INTRINSIC
coiled coil region	613	678	N/A	INTRINSIC
low complexity region	764	777	N/A	INTRINSIC
low complexity region	856	869	N/A	INTRINSIC
low complexity region	885	900	N/A	INTRINSIC
low complexity region	1077	1093	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1112	1240	5.1e-37	PFAM
coiled coil region	1289	1495	N/A	INTRINSIC
low complexity region	1682	1698	N/A	INTRINSIC
internal_repeat_5	1703	1750	8.04e-5	PROSPERO
internal_repeat_3	1704	1765	1.07e-5	PROSPERO
low complexity region	1769	1791	N/A	INTRINSIC
low complexity region	1835	1851	N/A	INTRINSIC
internal_repeat_5	1857	1900	8.04e-5	PROSPERO
internal_repeat_6	1887	1911	8.04e-5	PROSPERO
internal_repeat_3	1893	1955	1.07e-5	PROSPERO
internal_repeat_4	1949	1969	4.1e-5	PROSPERO
internal_repeat_1	1967	1993	1.42e-6	PROSPERO
low complexity region	1994	2007	N/A	INTRINSIC
low complexity region	2016	2055	N/A	INTRINSIC
low complexity region	2063	2088	N/A	INTRINSIC
internal_repeat_4	2091	2110	4.1e-5	PROSPERO
internal_repeat_6	2108	2132	8.04e-5	PROSPERO
low complexity region	2133	2152	N/A	INTRINSIC
internal_repeat_2	2158	2209	2.78e-6	PROSPERO
internal_repeat_1	2228	2253	1.42e-6	PROSPERO
internal_repeat_2	2230	2286	2.78e-6	PROSPERO
low complexity region	2313	2325	N/A	INTRINSIC
low complexity region	2337	2351	N/A	INTRINSIC
low complexity region	2366	2388	N/A	INTRINSIC
low complexity region	2420	2431	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132522

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147769

Meta Mutation Damage Score

0.0622

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.2%
20x: 91.9%

Validation Efficiency

95% (90/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,219,318	S600T	probably benign	Het
Acly	T	A	11: 100,495,891	Q615L	probably benign	Het
Adgrf1	C	A	17: 43,310,033	T387K	probably benign	Het
Afg3l1	G	T	8: 123,501,931	K745N	probably damaging	Het
Armc8	T	C	9: 99,536,259	T39A	possibly damaging	Het
Atm	C	A	9: 53,492,233		probably benign	Het
Babam2	A	G	5: 32,057,546	T324A	probably damaging	Het
Btd	C	A	14: 31,662,289	D77E	possibly damaging	Het
Cadm1	T	A	9: 47,829,370		probably benign	Het
Card11	A	T	5: 140,885,560	D729E	probably benign	Het
Ccni	G	T	5: 93,188,108	T144K	possibly damaging	Het
Cecr2	A	G	6: 120,731,267	T77A	probably damaging	Het
Cpsf7	T	C	19: 10,535,439	F296L	possibly damaging	Het
Cyfip1	C	A	7: 55,873,448	N70K	possibly damaging	Het
Cyp4a12b	A	G	4: 115,414,062		probably benign	Het
Ddx20	A	T	3: 105,678,580	Y816*	probably null	Het
Ddx59	A	G	1: 136,432,507	I420V	probably damaging	Het
Dgat1	T	A	15: 76,502,503	M445L	probably damaging	Het
Dnah5	T	A	15: 28,246,400	L628*	probably null	Het
Dnah7a	A	C	1: 53,559,148	D1409E	probably benign	Het
Dnmt1	T	C	9: 20,927,126	T215A	probably benign	Het
Dsg4	C	T	18: 20,471,245	T923M	probably damaging	Het
Enox1	A	G	14: 77,615,475	I394V	possibly damaging	Het
Esrp2	A	T	8: 106,134,618	M183K	probably damaging	Het
Fam171a1	C	T	2: 3,178,373	P79S	probably benign	Het
Fga	A	G	3: 83,031,775	T486A	probably benign	Het
Fkbp10	G	T	11: 100,415,889	A36S	probably benign	Het
Fnip1	A	G	11: 54,502,453	T572A	probably benign	Het
Fxn	A	C	19: 24,280,401		probably null	Het
Gaa	C	T	11: 119,284,498	Q901*	probably null	Het
Gabrg1	A	G	5: 70,754,251	M344T	probably benign	Het
Galnt7	C	T	8: 57,538,178	V433M	probably damaging	Het
Gin1	A	G	1: 97,785,226		probably null	Het
Gm5155	C	T	7: 17,873,330		noncoding transcript	Het
Hydin	A	C	8: 110,532,827	D2477A	probably benign	Het
Igsf6	T	C	7: 121,070,808	Y37C	probably damaging	Het
Il18rap	A	G	1: 40,531,527	I210V	probably benign	Het
Kif3a	T	C	11: 53,598,734	Y138H	probably damaging	Het
Klra17	A	G	6: 129,868,718		probably null	Het
Lcorl	A	T	5: 45,795,346	I55N	probably damaging	Het
Lrrc49	A	G	9: 60,602,776	S398P	possibly damaging	Het
Ltv1	A	G	10: 13,179,274	L384S	probably damaging	Het
Mageb3	A	T	2: 121,954,437	Y261*	probably null	Het
Mb21d1	A	G	9: 78,434,311		probably null	Het
Mical3	T	G	6: 121,042,235	T9P	probably benign	Het
Mpp6	T	G	6: 50,163,431	F144V	probably benign	Het
Myrip	C	T	9: 120,388,162	S49L	probably damaging	Het
Nrap	T	C	19: 56,384,055		probably benign	Het
Olfr164	T	C	16: 19,285,877	N289D	probably damaging	Het
Olfr729	A	G	14: 50,148,271	V201A	probably benign	Het
Otoa	A	T	7: 121,160,530		probably benign	Het
Parp11	T	A	6: 127,490,045	I133N	probably damaging	Het
Pcnx	A	G	12: 81,918,642	T528A	probably benign	Het
Pde4c	A	G	8: 70,726,989	H63R	probably benign	Het
Pdpk1	T	C	17: 24,110,904	K53E	probably damaging	Het
Pdzd7	A	T	19: 45,036,176	M468K	probably damaging	Het
Perm1	C	A	4: 156,218,604	P535Q	possibly damaging	Het
Pgap1	C	A	1: 54,535,969	A265S	probably benign	Het
Pik3c2a	A	T	7: 116,376,512		probably null	Het
Plxnd1	T	C	6: 115,980,601	T491A	possibly damaging	Het
Pms1	A	T	1: 53,206,969	D470E	probably benign	Het
Prf1	C	A	10: 61,302,983	T240N	probably damaging	Het
Prune2	A	G	19: 17,122,081	T1650A	probably benign	Het
Ptprf	A	G	4: 118,223,265	L1264P	probably benign	Het
Ptprs	A	G	17: 56,419,527	S948P	probably damaging	Het
Rapgef1	T	C	2: 29,686,256	V117A	probably damaging	Het
Rnf123	A	G	9: 108,062,926	V756A	probably benign	Het
Sez6l2	A	G	7: 126,967,119	E741G	probably damaging	Het
Shc3	A	T	13: 51,472,852	I125K	possibly damaging	Het
Smr3a	A	T	5: 88,008,058		probably benign	Het
Spef2	C	T	15: 9,584,108	E1624K	probably damaging	Het
St6gal1	A	T	16: 23,321,333	K85*	probably null	Het
Taf1b	T	G	12: 24,547,122	D353E	possibly damaging	Het
Tcp10b	C	T	17: 13,067,703	P180S	possibly damaging	Het
Tlr9	A	T	9: 106,224,943	M478L	probably benign	Het
Trio	C	T	15: 27,742,495	W22*	probably null	Het
Usp14	A	G	18: 10,024,673	V8A	probably damaging	Het
Vmn2r19	A	T	6: 123,330,052	K506N	possibly damaging	Het
Vmn2r45	T	A	7: 8,472,373	N552I	probably damaging	Het
Vmn2r56	A	T	7: 12,715,615	M232K	probably benign	Het
Vps13b	T	A	15: 35,910,642	F3517L	possibly damaging	Het
Yif1a	C	T	19: 5,092,305	R247*	probably null	Het
Zbtb5	A	G	4: 44,993,767	V539A	probably benign	Het
Zfp180	G	A	7: 24,105,227	R357Q	probably damaging	Het
Zfp536	A	G	7: 37,568,617	L458P	probably damaging	Het
Zfp646	G	A	7: 127,883,120	G1490S	probably benign	Het
Zfp970	C	T	2: 177,476,183	H517Y	probably damaging	Het
Zranb3	A	T	1: 128,017,556		probably null	Het

Other mutations in Tpr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Tpr	APN	1	150423696	splice site	probably benign
IGL00424:Tpr	APN	1	150398595	splice site	probably benign
IGL01095:Tpr	APN	1	150410140	missense	possibly damaging	0.95
IGL01347:Tpr	APN	1	150426987	missense	probably damaging	1.00
IGL01519:Tpr	APN	1	150431168	missense	probably benign	0.01
IGL01768:Tpr	APN	1	150444448	missense	possibly damaging	0.85
IGL01939:Tpr	APN	1	150413745	missense	possibly damaging	0.82
IGL01988:Tpr	APN	1	150426999	splice site	probably null
IGL02065:Tpr	APN	1	150413774	missense	probably benign	0.13
IGL02110:Tpr	APN	1	150435742	missense	probably damaging	0.97
IGL02311:Tpr	APN	1	150398653	missense	probably damaging	0.97
IGL02454:Tpr	APN	1	150431192	missense	probably benign	0.00
IGL02569:Tpr	APN	1	150425631	unclassified	probably benign
IGL03168:Tpr	APN	1	150408757	missense	probably benign	0.04
IGL03193:Tpr	APN	1	150440080	missense	possibly damaging	0.85
IGL03333:Tpr	APN	1	150426967	missense	probably benign	0.04
gridiron	UTSW	1	150423516	missense	probably damaging	1.00
Pouch	UTSW	1	150433772	missense	probably damaging	1.00
punt	UTSW	1	150418039	missense	probably benign	0.02
Turf	UTSW	1	150442245	critical splice donor site	probably null
F6893:Tpr	UTSW	1	150393562	missense	possibly damaging	0.84
PIT4305001:Tpr	UTSW	1	150440137	missense	possibly damaging	0.85
PIT4469001:Tpr	UTSW	1	150403956	missense	probably benign	0.41
R0085:Tpr	UTSW	1	150417413	missense	possibly damaging	0.95
R0101:Tpr	UTSW	1	150409302	splice site	probably benign
R0116:Tpr	UTSW	1	150410147	missense	probably damaging	0.98
R0136:Tpr	UTSW	1	150430595	missense	probably benign	0.01
R0207:Tpr	UTSW	1	150417427	missense	possibly damaging	0.74
R0219:Tpr	UTSW	1	150443258	splice site	probably null
R0380:Tpr	UTSW	1	150412947	missense	probably benign	0.27
R0403:Tpr	UTSW	1	150407414	splice site	probably benign
R0469:Tpr	UTSW	1	150423667	frame shift	probably null
R0480:Tpr	UTSW	1	150428241	missense	possibly damaging	0.83
R0514:Tpr	UTSW	1	150402273	missense	possibly damaging	0.55
R0563:Tpr	UTSW	1	150408858	missense	probably benign	0.13
R0631:Tpr	UTSW	1	150422531	missense	probably damaging	0.98
R0685:Tpr	UTSW	1	150433725	missense	possibly damaging	0.69
R0730:Tpr	UTSW	1	150393407	utr 5 prime	probably benign
R0739:Tpr	UTSW	1	150407497	missense	possibly damaging	0.94
R0780:Tpr	UTSW	1	150431341	missense	probably benign	0.00
R1018:Tpr	UTSW	1	150442183	missense	possibly damaging	0.53
R1084:Tpr	UTSW	1	150442161	missense	probably benign	0.18
R1532:Tpr	UTSW	1	150418000	missense	probably damaging	0.99
R1551:Tpr	UTSW	1	150436801	missense	probably benign	0.00
R1608:Tpr	UTSW	1	150426893	missense	probably damaging	0.96
R1759:Tpr	UTSW	1	150429524	missense	probably benign	0.19
R1932:Tpr	UTSW	1	150421663	missense	probably benign	0.00
R1978:Tpr	UTSW	1	150419907	missense	possibly damaging	0.65
R2031:Tpr	UTSW	1	150442119	missense	probably benign
R2176:Tpr	UTSW	1	150419940	missense	possibly damaging	0.56
R2235:Tpr	UTSW	1	150442092	missense	probably benign	0.33
R2339:Tpr	UTSW	1	150413774	missense	probably benign	0.01
R2367:Tpr	UTSW	1	150433728	missense	probably damaging	0.99
R2507:Tpr	UTSW	1	150392944	start codon destroyed	probably null
R3931:Tpr	UTSW	1	150435904	missense	probably damaging	1.00
R4320:Tpr	UTSW	1	150423574	missense	possibly damaging	0.96
R4439:Tpr	UTSW	1	150403961	missense	probably benign	0.01
R4568:Tpr	UTSW	1	150392959	unclassified	probably benign
R4644:Tpr	UTSW	1	150423499	missense	probably benign	0.01
R4665:Tpr	UTSW	1	150444399	missense	probably damaging	0.97
R4672:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4673:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4735:Tpr	UTSW	1	150442196	missense	possibly damaging	0.91
R4767:Tpr	UTSW	1	150430529	intron	probably benign
R4772:Tpr	UTSW	1	150413113	missense	possibly damaging	0.46
R4815:Tpr	UTSW	1	150398608	missense	probably benign	0.01
R4839:Tpr	UTSW	1	150449197	nonsense	probably null
R4844:Tpr	UTSW	1	150445879	missense	possibly damaging	0.86
R4925:Tpr	UTSW	1	150432565	missense	probably benign	0.00
R4967:Tpr	UTSW	1	150410059	missense	probably damaging	0.99
R5017:Tpr	UTSW	1	150398637	missense	probably benign	0.00
R5096:Tpr	UTSW	1	150446202	missense	probably damaging	0.99
R5353:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5354:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5484:Tpr	UTSW	1	150426888	missense	probably benign	0.33
R5601:Tpr	UTSW	1	150435853	missense	possibly damaging	0.75
R5642:Tpr	UTSW	1	150423818	missense	probably damaging	0.99
R5779:Tpr	UTSW	1	150423541	missense	probably damaging	1.00
R5787:Tpr	UTSW	1	150395286	missense	probably benign	0.01
R5892:Tpr	UTSW	1	150407400	missense	probably benign	0.44
R5915:Tpr	UTSW	1	150425649	missense	probably benign	0.15
R5928:Tpr	UTSW	1	150428127	missense	probably benign	0.30
R6146:Tpr	UTSW	1	150423162	missense	possibly damaging	0.83
R6154:Tpr	UTSW	1	150423816	missense	probably benign	0.00
R6234:Tpr	UTSW	1	150418039	missense	probably benign	0.02
R6263:Tpr	UTSW	1	150442245	critical splice donor site	probably null
R6318:Tpr	UTSW	1	150445888	missense	possibly damaging	0.93
R6550:Tpr	UTSW	1	150423977	missense	probably damaging	1.00
R6592:Tpr	UTSW	1	150411905	missense	possibly damaging	0.83
R6704:Tpr	UTSW	1	150406508	missense	possibly damaging	0.80
R6716:Tpr	UTSW	1	150414765	missense	probably damaging	1.00
R6836:Tpr	UTSW	1	150436673	splice site	probably null
R6886:Tpr	UTSW	1	150423965	missense	probably benign	0.00
R6894:Tpr	UTSW	1	150436847	missense	probably benign	0.28
R6928:Tpr	UTSW	1	150408785	missense	possibly damaging	0.83
R7011:Tpr	UTSW	1	150433772	missense	probably damaging	1.00
R7034:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7036:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7183:Tpr	UTSW	1	150406551	missense	probably damaging	1.00
R7221:Tpr	UTSW	1	150446178	missense	possibly damaging	0.96
R7223:Tpr	UTSW	1	150439256	missense	possibly damaging	0.53
R7294:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R7343:Tpr	UTSW	1	150393494	missense	unknown
R7361:Tpr	UTSW	1	150447621	missense	possibly damaging	0.73
R7405:Tpr	UTSW	1	150442127	missense	probably benign	0.02
R7637:Tpr	UTSW	1	150423516	missense	probably damaging	1.00
R7720:Tpr	UTSW	1	150429532	missense	possibly damaging	0.49
R7721:Tpr	UTSW	1	150444429	missense	probably benign
R7751:Tpr	UTSW	1	150419895	missense	probably benign	0.17
R7804:Tpr	UTSW	1	150432559	missense	probably damaging	0.99
R7878:Tpr	UTSW	1	150423660	missense	possibly damaging	0.67
R7973:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R8013:Tpr	UTSW	1	150398608	missense	probably benign
R8220:Tpr	UTSW	1	150432413	missense	probably benign	0.05
R8274:Tpr	UTSW	1	150423479	splice site	probably benign
R8428:Tpr	UTSW	1	150414813	missense	probably damaging	1.00
R8482:Tpr	UTSW	1	150433700	missense	probably damaging	1.00
R8699:Tpr	UTSW	1	150418021	missense	probably damaging	0.99
R8859:Tpr	UTSW	1	150408846	missense	possibly damaging	0.90
R9119:Tpr	UTSW	1	150404002	missense	probably damaging	0.99
R9326:Tpr	UTSW	1	150425656	missense	possibly damaging	0.86
X0021:Tpr	UTSW	1	150395207	missense	probably damaging	1.00
Z1177:Tpr	UTSW	1	150428235	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCATGATTGTAACATGTCCTTTGTC -3'
(R):5'- CCTTCATAGCATGCAGGAAGAG -3'

Sequencing Primer
(F):5'- CCTTTGTCATGTTAAGAATTTCTAGC -3'
(R):5'- AGGGGATTTAGTTTCACGACAG -3'

Posted On

2014-06-23