Incidental Mutation 'R1919:Atxn2l'
ID 212843
Institutional Source Beutler Lab
Gene Symbol Atxn2l
Ensembl Gene ENSMUSG00000032637
Gene Name ataxin 2-like
Synonyms A2lp, A2D, A2RP, A2LG
MMRRC Submission 039937-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock # R1919 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 126491708-126503437 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 126493168 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 70 (T70I)
Ref Sequence ENSEMBL: ENSMUSP00000145768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040202] [ENSMUST00000098048] [ENSMUST00000106392] [ENSMUST00000166682] [ENSMUST00000167759] [ENSMUST00000206055] [ENSMUST00000206265] [ENSMUST00000206572] [ENSMUST00000206577]
AlphaFold Q7TQH0
Predicted Effect possibly damaging
Transcript: ENSMUST00000040202
AA Change: T969I

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035415
Gene: ENSMUSG00000032637
AA Change: T969I

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 36 54 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Pfam:SM-ATX 119 189 8.5e-21 PFAM
LsmAD 262 331 1.95e-28 SMART
low complexity region 357 382 N/A INTRINSIC
low complexity region 450 470 N/A INTRINSIC
Pfam:PAM2 657 672 5.6e-8 PFAM
low complexity region 681 697 N/A INTRINSIC
low complexity region 764 787 N/A INTRINSIC
low complexity region 920 947 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098048
SMART Domains Protein: ENSMUSP00000095656
Gene: ENSMUSG00000073838

DomainStartEndE-ValueType
Pfam:GTP_EFTU 55 249 2e-55 PFAM
Pfam:GTP_EFTU_D2 272 341 1.3e-15 PFAM
Pfam:GTP_EFTU_D3 345 440 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106392
SMART Domains Protein: ENSMUSP00000102000
Gene: ENSMUSG00000073838

DomainStartEndE-ValueType
Pfam:GTP_EFTU 55 249 2.7e-57 PFAM
Pfam:GTP_EFTU_D2 272 341 2.1e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166682
AA Change: T849I

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125881
Gene: ENSMUSG00000032637
AA Change: T849I

DomainStartEndE-ValueType
Pfam:SM-ATX 1 69 1.6e-21 PFAM
LsmAD 142 211 1.95e-28 SMART
low complexity region 237 262 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
Pfam:PAM2 537 553 4.3e-8 PFAM
low complexity region 561 577 N/A INTRINSIC
low complexity region 644 667 N/A INTRINSIC
low complexity region 800 827 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167759
AA Change: T883I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132959
Gene: ENSMUSG00000032637
AA Change: T883I

DomainStartEndE-ValueType
Pfam:SM-ATX 33 103 8.1e-23 PFAM
LsmAD 176 245 1.95e-28 SMART
low complexity region 271 296 N/A INTRINSIC
low complexity region 364 384 N/A INTRINSIC
Pfam:PAM2 571 587 4.2e-8 PFAM
low complexity region 595 611 N/A INTRINSIC
low complexity region 678 701 N/A INTRINSIC
low complexity region 834 861 N/A INTRINSIC
low complexity region 893 905 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
low complexity region 944 960 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205478
Predicted Effect probably benign
Transcript: ENSMUST00000206055
Predicted Effect probably damaging
Transcript: ENSMUST00000206265
AA Change: T70I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000206572
Predicted Effect probably damaging
Transcript: ENSMUST00000206577
AA Change: T963I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ataxin type 2 related protein of unknown function. This protein is a member of the spinocerebellar ataxia (SCAs) family, which is associated with a complex group of neurodegenerative disorders. Several alternatively spliced transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,270 E740G probably damaging Het
4930474N05Rik G T 14: 36,095,457 V105F possibly damaging Het
4932438A13Rik A G 3: 37,006,983 probably null Het
Actr10 A G 12: 70,942,330 I74M probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Afm A T 5: 90,524,920 K205* probably null Het
Ankrd27 T A 7: 35,632,985 S846T probably benign Het
Ano3 A G 2: 110,885,007 S29P probably benign Het
Apaf1 C T 10: 91,077,614 W138* probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgef4 A G 1: 34,811,140 Q1798R probably damaging Het
Astn1 G A 1: 158,509,971 V416I probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bspry T A 4: 62,494,797 C256S probably damaging Het
C3 C A 17: 57,220,135 W771C probably damaging Het
Camkv A G 9: 107,947,088 D233G possibly damaging Het
Catsperd T A 17: 56,635,548 V109E probably damaging Het
Cd101 A G 3: 101,018,917 L162P probably damaging Het
Cdr2l A G 11: 115,392,777 T154A probably damaging Het
Clca3a2 G C 3: 144,810,696 Q380E probably benign Het
Col6a3 T C 1: 90,822,359 N251S possibly damaging Het
Cttnbp2nl A G 3: 105,011,278 V82A possibly damaging Het
Cux1 G A 5: 136,363,319 Q194* probably null Het
Daam2 T C 17: 49,485,457 E361G probably benign Het
Dcaf17 A T 2: 71,078,172 probably null Het
Dnaic1 T C 4: 41,570,020 probably null Het
Eml5 T C 12: 98,798,839 Y1617C probably damaging Het
Epb41l4b T C 4: 57,040,993 E490G probably damaging Het
Epha7 T C 4: 28,963,969 M988T possibly damaging Het
Fancm T C 12: 65,105,520 C917R possibly damaging Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm3604 G T 13: 62,369,942 H201N probably benign Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpatch8 A G 11: 102,508,142 probably null Het
H2-M3 T C 17: 37,271,189 Y179H possibly damaging Het
H2-Q10 C A 17: 35,470,488 S62R probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Hrg A T 16: 22,954,457 Q113H probably damaging Het
Kcnj16 T C 11: 111,024,953 V147A possibly damaging Het
Kif1a T C 1: 93,019,031 I1650V possibly damaging Het
Kmt2a C T 9: 44,820,345 probably benign Het
Krt90 A T 15: 101,557,230 Y319N probably damaging Het
Lipo4 T C 19: 33,499,271 N359S possibly damaging Het
Lrp1b G T 2: 41,728,729 T225K probably benign Het
Map1a C T 2: 121,307,012 P2532S probably damaging Het
Mmrn2 A G 14: 34,397,643 D193G probably benign Het
Mpped2 T A 2: 106,867,032 I284N probably damaging Het
Msh6 A G 17: 87,985,125 H436R probably benign Het
Mterf3 A T 13: 66,930,062 S48T probably damaging Het
Muc5b T C 7: 141,846,031 F414L unknown Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Nploc4 A G 11: 120,404,229 Y420H probably damaging Het
Npr2 T A 4: 43,640,578 Y344N probably damaging Het
Nsun5 A G 5: 135,375,598 T397A probably benign Het
Ntsr2 A T 12: 16,654,110 Q204L probably damaging Het
Nwd2 T A 5: 63,806,180 Y1036N probably damaging Het
Oacyl T C 18: 65,710,547 V105A possibly damaging Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Parp3 T A 9: 106,475,117 Q70L possibly damaging Het
Parp4 T C 14: 56,624,017 S936P probably damaging Het
Pdzd3 T C 9: 44,250,303 D93G possibly damaging Het
Phkb A G 8: 85,922,161 E202G probably benign Het
Pink1 T C 4: 138,314,020 N530S probably benign Het
Pou3f2 T C 4: 22,487,119 D338G probably damaging Het
Prss8 G T 7: 127,929,858 L9I probably benign Het
Ptpn22 G A 3: 103,876,738 probably null Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Rasef A G 4: 73,744,114 S200P possibly damaging Het
Rb1 T A 14: 73,212,990 K645* probably null Het
Robo2 C T 16: 73,899,154 G1367D probably benign Het
Rp1 A G 1: 4,352,671 V52A probably damaging Het
Samd13 T C 3: 146,662,712 T23A probably benign Het
Scn7a T C 2: 66,699,973 H676R probably damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Slc2a8 T C 2: 32,980,079 Y150C probably damaging Het
Slc7a6os C A 8: 106,210,564 R88L probably damaging Het
Slc8a2 A G 7: 16,152,920 I657V probably benign Het
Slit2 C A 5: 48,191,016 probably benign Het
Spire2 A G 8: 123,363,071 D447G probably benign Het
Sptlc3 A G 2: 139,566,675 N237D possibly damaging Het
Stk3 G A 15: 35,073,217 T119I probably damaging Het
Suv39h2 G A 2: 3,464,316 T334I probably damaging Het
Syt5 G T 7: 4,540,279 T327N probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tnks A T 8: 34,875,232 V388D probably damaging Het
Ugt2b1 T C 5: 86,926,000 T167A probably benign Het
Usp40 G A 1: 87,995,842 R236C possibly damaging Het
Utrn T C 10: 12,455,480 D2904G probably benign Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn2r23 T C 6: 123,713,010 S282P possibly damaging Het
Vps45 T C 3: 96,046,440 E200G probably benign Het
Wnt7b T A 15: 85,559,080 I41F probably damaging Het
Zmym6 T A 4: 127,103,414 N275K probably damaging Het
Other mutations in Atxn2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Atxn2l APN 7 126498288 missense possibly damaging 0.94
IGL00507:Atxn2l APN 7 126496584 missense possibly damaging 0.51
IGL00846:Atxn2l APN 7 126499178 missense probably damaging 1.00
IGL01813:Atxn2l APN 7 126500253 missense probably damaging 1.00
PIT4378001:Atxn2l UTSW 7 126497271 missense probably benign 0.11
R0005:Atxn2l UTSW 7 126498274 missense probably damaging 1.00
R0267:Atxn2l UTSW 7 126493207 missense probably damaging 1.00
R0608:Atxn2l UTSW 7 126501416 splice site probably null
R0749:Atxn2l UTSW 7 126500837 missense possibly damaging 0.50
R0831:Atxn2l UTSW 7 126499160 missense probably damaging 1.00
R0881:Atxn2l UTSW 7 126496596 missense probably damaging 1.00
R1022:Atxn2l UTSW 7 126497294 missense probably benign 0.01
R1024:Atxn2l UTSW 7 126497294 missense probably benign 0.01
R1081:Atxn2l UTSW 7 126494212 missense probably damaging 1.00
R1132:Atxn2l UTSW 7 126494248 small deletion probably benign
R1489:Atxn2l UTSW 7 126496467 missense probably damaging 1.00
R2062:Atxn2l UTSW 7 126495866 missense probably damaging 1.00
R2170:Atxn2l UTSW 7 126503239 start gained probably benign
R3719:Atxn2l UTSW 7 126498130 missense probably damaging 1.00
R3861:Atxn2l UTSW 7 126501951 critical splice donor site probably null
R5061:Atxn2l UTSW 7 126500203 missense probably damaging 1.00
R6022:Atxn2l UTSW 7 126496435 critical splice donor site probably null
R6075:Atxn2l UTSW 7 126492517 missense possibly damaging 0.70
R6131:Atxn2l UTSW 7 126503165 unclassified probably benign
R6460:Atxn2l UTSW 7 126494248 small deletion probably benign
R6552:Atxn2l UTSW 7 126493821 missense possibly damaging 0.70
R7167:Atxn2l UTSW 7 126499222 missense possibly damaging 0.76
R7234:Atxn2l UTSW 7 126493201 missense probably damaging 1.00
R7301:Atxn2l UTSW 7 126494211 nonsense probably null
R7432:Atxn2l UTSW 7 126493874 missense possibly damaging 0.46
R7691:Atxn2l UTSW 7 126492610 critical splice acceptor site probably null
R7711:Atxn2l UTSW 7 126501269 missense probably damaging 1.00
R7849:Atxn2l UTSW 7 126493173 missense possibly damaging 0.48
R7870:Atxn2l UTSW 7 126492752 missense probably benign
R8907:Atxn2l UTSW 7 126500253 missense probably damaging 1.00
R8929:Atxn2l UTSW 7 126493756 splice site probably benign
R8949:Atxn2l UTSW 7 126492205 missense probably damaging 0.99
R8982:Atxn2l UTSW 7 126494248 small deletion probably benign
R9021:Atxn2l UTSW 7 126495540 missense probably benign 0.00
R9127:Atxn2l UTSW 7 126498221 missense probably damaging 1.00
R9145:Atxn2l UTSW 7 126494248 small deletion probably benign
RF006:Atxn2l UTSW 7 126495891 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTCCAGTTTGGACATGGG -3'
(R):5'- CACTTCTACTCTGGCAGCAC -3'

Sequencing Primer
(F):5'- GGCCTGTAGAAGAGAATTAGTTTC -3'
(R):5'- TCACCTGGGCAGTGGACAG -3'
Posted On 2014-07-14